EMAIL THIS PAGE TO A FRIEND

MEIS1

Meis homeobox 1

255 Gene Product Result for
UniProtKB ID: O00470, A8MV50
Gene ID:
Human(4211) Summary: Homeobox genes, of which the most well-characterized category is represented by the HOX genes, play a crucial role in normal development. In addition, several homeoproteins are involved in neoplasia. This gene encodes a homeobox protein belonging to the TALE ('three amino acid loop extension') family of homeodomain-containing proteins. [provided by RefSeq, Jul 2008]
Mouse(17268) Meis homeobox 1
Rat(686117) Meis homeobox 1
Zebrafish(170446) myeloid ecotropic viral integration 1
chicken(395589) Meis homeobox 1
domestic cat(101088155) Meis homeobox 1
cow(613877) Meis homeobox 1
Horse(100051257) Meis homeobox 1
dog(474619) Meis homeobox 1
naked mole-rat(101708428) Meis homeobox 1
Domestic Rabbit(100338305) Meis homeobox 1
sheep(101112041) Meis homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002398 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002398 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002398 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010789 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010789 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010789 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002398 Rosetta Predictions human pricing
NM_001134702 Rosetta Predictions rat pricing
NM_010789 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088989 predicted 966
2 SASI_Hs01_00088993 predicted 1021
3 SASI_Hs01_00088994 predicted 1001
4 SASI_Hs01_00088995 predicted 954
5 SASI_Hs01_00088997 predicted 1001
6 SASI_Hs02_00333762 predicted 1491
7 SASI_Hs01_00088998 predicted 1339
8 SASI_Hs02_00333763 predicted 1620
9 SASI_Hs02_00333764 predicted 893
10 SASI_Hs02_00333765 predicted 931
11 SASI_Hs01_00088990 predicted 954
12 SASI_Hs01_00088991 predicted 834
13 SASI_Hs01_00088992 predicted 904
14 SASI_Hs01_00088996 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134702 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258034 predicted 547
2 SASI_Rn02_00258035 predicted 594
3 SASI_Rn02_00258036 predicted 494
4 SASI_Rn02_00258037 predicted 1173
5 SASI_Rn02_00258038 predicted 1311
6 SASI_Rn02_00258039 predicted 410
7 SASI_Rn02_00258040 predicted 597
8 SASI_Rn02_00258041 predicted 488
9 SASI_Rn02_00258042 predicted 1220
10 SASI_Rn02_00258043 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010789 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031743 predicted 944
2 SASI_Mm01_00031744 predicted 988
3 SASI_Mm01_00031745 predicted 822
4 SASI_Mm01_00031746 predicted 881
5 SASI_Mm01_00031747 predicted 1868
6 SASI_Mm01_00031748 predicted 1381
7 SASI_Mm01_00031749 predicted 938
8 SASI_Mm02_00319360 predicted 988
9 SASI_Mm01_00031750 predicted 804
10 SASI_Mm01_00031751 predicted 1604
11 SASI_Mm01_00031752 predicted 1326
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002398
MEIS1 MISSION shRNA Bacterial Glycerol Stock
Meis homeobox 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002398.2-2637s1c1
Sequence:CCGGGCCGTGTGTTTAGAAGCCTAACTCGAGTTAGGCTTCTAAACACACGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002398.2-1088s1c1
Sequence:CCGGCCCTCTTGGAACAGAGATCATCTCGAGATGATCTCTGTTCCAAGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002398.2-971s1c1
Sequence:CCGGCGGTATATTAGCTGTTTGAAACTCGAGTTTCAAACAGCTAATATACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002398.2-1333s1c1
Sequence:CCGGCCAGCATCTAACACACCCTTACTCGAGTAAGGGTGTGTTAGATGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002398.2-892s21c1
Sequence:CCGGGATTCAAGCCATACAAGTATTCTCGAGAATACTTGTATGGCTTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002398.2-1625s21c1
Sequence:CCGGATGTAACCTTCATCTAGTTAACTCGAGTTAACTAGATGAAGGTTACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002398
MEIS1 MISSION shRNA shRNA Plasmid DNA
Meis homeobox 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002398.2-2637s1c1
Sequence:CCGGGCCGTGTGTTTAGAAGCCTAACTCGAGTTAGGCTTCTAAACACACGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002398.2-1088s1c1
Sequence:CCGGCCCTCTTGGAACAGAGATCATCTCGAGATGATCTCTGTTCCAAGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002398.2-971s1c1
Sequence:CCGGCGGTATATTAGCTGTTTGAAACTCGAGTTTCAAACAGCTAATATACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002398.2-1333s1c1
Sequence:CCGGCCAGCATCTAACACACCCTTACTCGAGTAAGGGTGTGTTAGATGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002398.2-892s21c1
Sequence:CCGGGATTCAAGCCATACAAGTATTCTCGAGAATACTTGTATGGCTTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002398.2-1625s21c1
Sequence:CCGGATGTAACCTTCATCTAGTTAACTCGAGTTAACTAGATGAAGGTTACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002398
MEIS1 MISSION shRNA Lentiviral Transduction Particles
Meis homeobox 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002398.2-2637s1c1
Sequence:CCGGGCCGTGTGTTTAGAAGCCTAACTCGAGTTAGGCTTCTAAACACACGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002398.2-1088s1c1
Sequence:CCGGCCCTCTTGGAACAGAGATCATCTCGAGATGATCTCTGTTCCAAGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002398.2-971s1c1
Sequence:CCGGCGGTATATTAGCTGTTTGAAACTCGAGTTTCAAACAGCTAATATACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002398.2-1333s1c1
Sequence:CCGGCCAGCATCTAACACACCCTTACTCGAGTAAGGGTGTGTTAGATGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002398.2-892s21c1
Sequence:CCGGGATTCAAGCCATACAAGTATTCTCGAGAATACTTGTATGGCTTGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002398.2-1625s21c1
Sequence:CCGGATGTAACCTTCATCTAGTTAACTCGAGTTAACTAGATGAAGGTTACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010789
MEIS1 MISSION shRNA Bacterial Glycerol Stock
Meis homeobox 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010789.1-1392s1c1
Sequence:CCGGCCATCCTTCAAGTGAACAATTCTCGAGAATTGTTCACTTGAAGGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010789.1-932s1c1
Sequence:CCGGGTACACGAATTATGTGACAATCTCGAGATTGTCACATAATTCGTGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010789.1-822s1c1
Sequence:CCGGCCAAACAGATTCGCGCAGAAACTCGAGTTTCTGCGCGAATCTGTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010789.1-642s1c1
Sequence:CCGGCCTCGGTCAATGACGCTTTAACTCGAGTTAAAGCGTCATTGACCGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010789.1-2448s1c1
Sequence:CCGGCCATATTTGAATTGGCCTGAACTCGAGTTCAGGCCAATTCAAATATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010789.2-1617s21c1
Sequence:CCGGGTATGGGACAGCCGAGTTATACTCGAGTATAACTCGGCTGTCCCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010789.2-2084s21c1
Sequence:CCGGTTATCCATATTACGTTGTTTCCTCGAGGAAACAACGTAATATGGATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010789.2-924s21c1
Sequence:CCGGTAGAGAAGGTACACGAATTATCTCGAGATAATTCGTGTACCTTCTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010789.2-1474s21c1
Sequence:CCGGCAGCCAAGGGACACCTTATAACTCGAGTTATAAGGTGTCCCTTGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010789.2-641s21c1
Sequence:CCGGTCCTCGGTCAATGACGCTTTACTCGAGTAAAGCGTCATTGACCGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010789.2-2178s21c1
Sequence:CCGGCAGAAGCCTCCTTACATTAAACTCGAGTTTAATGTAAGGAGGCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010789.2-1832s21c1
Sequence:CCGGATTCACGCTCAGTAGCTTAAGCTCGAGCTTAAGCTACTGAGCGTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010789.2-949s21c1
Sequence:CCGGCAATTTCTGCCACCGGTATATCTCGAGATATACCGGTGGCAGAAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010789
MEIS1 MISSION shRNA shRNA Plasmid DNA
Meis homeobox 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010789.1-1392s1c1
Sequence:CCGGCCATCCTTCAAGTGAACAATTCTCGAGAATTGTTCACTTGAAGGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010789.1-932s1c1
Sequence:CCGGGTACACGAATTATGTGACAATCTCGAGATTGTCACATAATTCGTGTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010789.1-822s1c1
Sequence:CCGGCCAAACAGATTCGCGCAGAAACTCGAGTTTCTGCGCGAATCTGTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010789.1-642s1c1
Sequence:CCGGCCTCGGTCAATGACGCTTTAACTCGAGTTAAAGCGTCATTGACCGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010789.1-2448s1c1
Sequence:CCGGCCATATTTGAATTGGCCTGAACTCGAGTTCAGGCCAATTCAAATATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010789.2-1617s21c1
Sequence:CCGGGTATGGGACAGCCGAGTTATACTCGAGTATAACTCGGCTGTCCCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010789.2-2084s21c1
Sequence:CCGGTTATCCATATTACGTTGTTTCCTCGAGGAAACAACGTAATATGGATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010789.2-924s21c1
Sequence:CCGGTAGAGAAGGTACACGAATTATCTCGAGATAATTCGTGTACCTTCTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010789.2-1474s21c1
Sequence:CCGGCAGCCAAGGGACACCTTATAACTCGAGTTATAAGGTGTCCCTTGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010789.2-641s21c1
Sequence:CCGGTCCTCGGTCAATGACGCTTTACTCGAGTAAAGCGTCATTGACCGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010789.2-2178s21c1
Sequence:CCGGCAGAAGCCTCCTTACATTAAACTCGAGTTTAATGTAAGGAGGCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010789.2-1832s21c1
Sequence:CCGGATTCACGCTCAGTAGCTTAAGCTCGAGCTTAAGCTACTGAGCGTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010789.2-949s21c1
Sequence:CCGGCAATTTCTGCCACCGGTATATCTCGAGATATACCGGTGGCAGAAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010789
MEIS1 MISSION shRNA Lentiviral Transduction Particles
Meis homeobox 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010789.1-1392s1c1
Sequence:CCGGCCATCCTTCAAGTGAACAATTCTCGAGAATTGTTCACTTGAAGGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010789.1-932s1c1
Sequence:CCGGGTACACGAATTATGTGACAATCTCGAGATTGTCACATAATTCGTGTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010789.1-822s1c1
Sequence:CCGGCCAAACAGATTCGCGCAGAAACTCGAGTTTCTGCGCGAATCTGTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010789.1-642s1c1
Sequence:CCGGCCTCGGTCAATGACGCTTTAACTCGAGTTAAAGCGTCATTGACCGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010789.1-2448s1c1
Sequence:CCGGCCATATTTGAATTGGCCTGAACTCGAGTTCAGGCCAATTCAAATATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010789.2-1617s21c1
Sequence:CCGGGTATGGGACAGCCGAGTTATACTCGAGTATAACTCGGCTGTCCCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010789.2-2084s21c1
Sequence:CCGGTTATCCATATTACGTTGTTTCCTCGAGGAAACAACGTAATATGGATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010789.2-924s21c1
Sequence:CCGGTAGAGAAGGTACACGAATTATCTCGAGATAATTCGTGTACCTTCTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010789.2-1474s21c1
Sequence:CCGGCAGCCAAGGGACACCTTATAACTCGAGTTATAAGGTGTCCCTTGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010789.2-641s21c1
Sequence:CCGGTCCTCGGTCAATGACGCTTTACTCGAGTAAAGCGTCATTGACCGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010789.2-2178s21c1
Sequence:CCGGCAGAAGCCTCCTTACATTAAACTCGAGTTTAATGTAAGGAGGCTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010789.2-1832s21c1
Sequence:CCGGATTCACGCTCAGTAGCTTAAGCTCGAGCTTAAGCTACTGAGCGTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010789.2-949s21c1
Sequence:CCGGCAATTTCTGCCACCGGTATATCTCGAGATATACCGGTGGCAGAAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)