EMAIL THIS PAGE TO A FRIEND

MEIS2

Meis homeobox 2

269 Gene Product Result for
Synonyms: HsT18361 MRG1
Gene ID:
Human(4212) Summary: This gene encodes a homeobox protein belonging to the TALE ('three amino acid loop extension') family of homeodomain-containing proteins. TALE homeobox proteins are highly conserved transcription regulators, and several members have been shown to be essential contributors to developmental programs. Multiple transcript variants encoding distinct isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(17536) Meis homeobox 2
Rat(311311) Meis homeobox 2
chicken(395588) Meis homeobox 2
cow(539573) Meis homeobox 2
Horse(100057556) Meis homeobox 2
domestic cat(101094023) Meis homeobox 2
dog(612759) Meis homeobox 2
Goat(100860970) Meis homeobox 2
sheep(101104751) Meis homeobox 2
naked mole-rat(101696332) Meis homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101464 Anti-MEIS2 (ab1) antibody produced in rabbit affinity isolated antibody, lyophilized powder zebrafish, mouse, chicken, horse, rabbit, human, canine, rat
western blot pricing
SAB2101465 Anti-MEIS2 (ab2) antibody produced in rabbit affinity isolated antibody rat, human, canine, horse, zebrafish, bovine, rabbit, mouse, guinea pig
western blot pricing
SAB2501583 Anti-MEIS2 antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, mouse, human, bovine
ELISA, western blot pricing
SAB2108174 Anti-MEIS2 antibody produced in rabbit affinity isolated antibody horse, human, rat, mouse, rabbit, zebrafish, guinea pig, canine
western blot pricing
HPA003256 Anti-MEIS2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
AV34684 Anti-MEIS2 antibody produced in rabbit IgG fraction of antiserum guinea pig, rabbit, human, horse, mouse, zebrafish, canine, bovine, rat
immunohistochemistry, western blot pricing
WH0004212M1 Monoclonal Anti-MEIS2 antibody produced in mouse clone 1H4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404068 Monoclonal Anti-MEIS2 antibody produced in mouse clone 1D1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010825 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010825 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010825 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002399 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002399 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002399 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU047711 MISSION® esiRNA esiRNA targeting mouse Meis2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002399 Rosetta Predictions human pricing
NM_020149 Rosetta Predictions human pricing
NM_170674 Rosetta Predictions human pricing
NM_170675 Rosetta Predictions human pricing
NM_170676 Rosetta Predictions human pricing
NM_170677 Rosetta Predictions human pricing
NM_172315 Rosetta Predictions human pricing
NM_172316 Rosetta Predictions human pricing
NM_001107758 Rosetta Predictions rat pricing
NM_010825 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232428 predicted 879
2 SASI_Hs01_00232429 predicted 1996
3 SASI_Hs01_00232433 predicted 993
4 SASI_Hs02_00333766 predicted 1053
5 SASI_Hs01_00232435 predicted 896
6 SASI_Hs02_00333767 predicted 1103
7 SASI_Hs02_00333768 predicted 1046
8 SASI_Hs02_00333769 predicted 1865
9 SASI_Hs02_00333770 predicted 1876
10 SASI_Hs02_00333771 predicted 1160
11 SASI_Hs01_00232427 predicted 945
12 SASI_Hs01_00232430 predicted 976
13 SASI_Hs01_00232431 predicted 1895
14 SASI_Hs01_00232432 predicted 1018
15 SASI_Hs01_00232434 predicted 1032
16 SASI_Hs01_00232436 predicted 1971
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020149 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022662 predicted 1590
2 SASI_Hs01_00022663 predicted 1531
3 SASI_Hs01_00022664 predicted 1623
4 SASI_Hs01_00022665 predicted 1654
5 SASI_Hs01_00022666 predicted 1636
6 SASI_Hs01_00022667 predicted 1673
7 SASI_Hs01_00022668 predicted 1538
8 SASI_Hs01_00022669 predicted 1699
9 SASI_Hs01_00022670 predicted 1275
10 SASI_Hs01_00022671 predicted 1965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170674 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204079 predicted 1528
2 SASI_Hs01_00204080 predicted 2638
3 SASI_Hs01_00204084 predicted 1634
4 SASI_Hs02_00367577 predicted 1694
5 SASI_Hs01_00204086 predicted 1534
6 SASI_Hs02_00367578 predicted 1748
7 SASI_Hs02_00367579 predicted 1693
8 SASI_Hs02_00367580 predicted 2500
9 SASI_Hs02_00367581 predicted 2511
10 SASI_Hs02_00367582 predicted 1802
11 SASI_Hs01_00204078 predicted 1590
12 SASI_Hs01_00204081 predicted 1618
13 SASI_Hs01_00204082 predicted 2528
14 SASI_Hs01_00204083 predicted 1652
15 SASI_Hs01_00204085 predicted 1667
16 SASI_Hs01_00204087 predicted 2608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075345 predicted 1524
2 SASI_Hs01_00075346 predicted 2557
3 SASI_Hs01_00075350 predicted 1637
4 SASI_Hs02_00367583 predicted 1702
5 SASI_Hs01_00075352 predicted 1538
6 SASI_Hs02_00367584 predicted 1746
7 SASI_Hs02_00367585 predicted 1696
8 SASI_Hs02_00367586 predicted 2429
9 SASI_Hs02_00367587 predicted 2437
10 SASI_Hs02_00367588 predicted 1805
11 SASI_Hs01_00075344 predicted 1587
12 SASI_Hs01_00075347 predicted 1626
13 SASI_Hs01_00075348 predicted 2453
14 SASI_Hs01_00075349 predicted 1653
15 SASI_Hs01_00075351 predicted 1671
16 SASI_Hs01_00075353 predicted 2540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201358 predicted 1523
2 SASI_Hs01_00201359 predicted 2536
3 SASI_Hs01_00201363 predicted 1632
4 SASI_Hs02_00367589 predicted 1703
5 SASI_Hs01_00201365 predicted 1537
6 SASI_Hs02_00367590 predicted 1747
7 SASI_Hs02_00367591 predicted 1687
8 SASI_Hs02_00367592 predicted 2405
9 SASI_Hs02_00367593 predicted 2417
10 SASI_Hs02_00367594 predicted 1801
11 SASI_Hs01_00201357 predicted 1584
12 SASI_Hs01_00201360 predicted 1617
13 SASI_Hs01_00201361 predicted 2438
14 SASI_Hs01_00201362 predicted 1655
15 SASI_Hs01_00201364 predicted 1674
16 SASI_Hs01_00201366 predicted 2510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246717 predicted 1527
2 SASI_Hs01_00246718 predicted 2650
3 SASI_Hs01_00246722 predicted 1638
4 SASI_Hs02_00367595 predicted 1698
5 SASI_Hs01_00246724 predicted 1537
6 SASI_Hs02_00367596 predicted 1745
7 SASI_Hs02_00367597 predicted 1689
8 SASI_Hs02_00367598 predicted 2519
9 SASI_Hs02_00367599 predicted 2529
10 SASI_Hs02_00367600 predicted 1802
11 SASI_Hs01_00246716 predicted 1593
12 SASI_Hs01_00246719 predicted 1626
13 SASI_Hs01_00246720 predicted 2553
14 SASI_Hs01_00246721 predicted 1661
15 SASI_Hs01_00246723 predicted 1666
16 SASI_Hs01_00246725 predicted 2634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172315 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028522 predicted 580
2 SASI_Hs01_00028523 predicted 1710
3 SASI_Hs01_00028527 predicted 687
4 SASI_Hs02_00367973 predicted 752
5 SASI_Hs01_00028529 predicted 588
6 SASI_Hs02_00367974 predicted 805
7 SASI_Hs02_00367975 predicted 747
8 SASI_Hs02_00367976 predicted 1572
9 SASI_Hs02_00367977 predicted 1584
10 SASI_Hs02_00367978 predicted 856
11 SASI_Hs01_00028521 predicted 648
12 SASI_Hs01_00028524 predicted 672
13 SASI_Hs01_00028525 predicted 1609
14 SASI_Hs01_00028526 predicted 709
15 SASI_Hs01_00028528 predicted 727
16 SASI_Hs01_00028530 predicted 1681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172316 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084299 predicted 945
2 SASI_Hs01_00084300 predicted 2062
3 SASI_Hs01_00084304 predicted 1061
4 SASI_Hs02_00367979 predicted 1127
5 SASI_Hs01_00084306 predicted 962
6 SASI_Hs02_00367980 predicted 1170
7 SASI_Hs02_00367981 predicted 1111
8 SASI_Hs02_00367982 predicted 1926
9 SASI_Hs02_00367983 predicted 1937
10 SASI_Hs02_00367984 predicted 1222
11 SASI_Hs01_00084298 predicted 1008
12 SASI_Hs01_00084301 predicted 1041
13 SASI_Hs01_00084302 predicted 1953
14 SASI_Hs01_00084303 predicted 1084
15 SASI_Hs01_00084305 predicted 1088
16 SASI_Hs01_00084307 predicted 2029
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107758 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231975 predicted 1710
2 SASI_Rn02_00231976 predicted 787
3 SASI_Rn02_00231977 predicted 471
4 SASI_Rn02_00231978 predicted 676
5 SASI_Rn02_00231979 predicted 1579
6 SASI_Rn02_00231980 predicted 837
7 SASI_Rn02_00231981 predicted 897
8 SASI_Rn02_00231982 predicted 1692
9 SASI_Rn02_00231983 predicted 1280
10 SASI_Rn02_00231984 predicted 1267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010825 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201567 predicted 542
2 SASI_Mm01_00201568 predicted 1247
3 SASI_Mm01_00201570 predicted 1254
4 SASI_Mm02_00319444 predicted 913
5 SASI_Mm01_00201571 predicted 511
6 SASI_Mm01_00201572 predicted 861
7 SASI_Mm01_00201573 predicted 1353
8 SASI_Mm01_00201575 predicted 530
9 SASI_Mm01_00201576 predicted 926
10 SASI_Mm02_00319445 predicted 1457
11 SASI_Mm01_00201569 predicted 759
12 SASI_Mm01_00201574 predicted 749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010825
MEIS2 MISSION shRNA Bacterial Glycerol Stock
Meis homeobox 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010825.3-661s21c1
Sequence:CCGGCAAACCCAGAGCTGGATAATTCTCGAGAATTATCCAGCTCTGGGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010825.3-484s21c1
Sequence:CCGGTCTATGGGCACCCGTTGTTTCCTCGAGGAAACAACGGGTGCCCATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010825.3-1593s21c1
Sequence:CCGGCCCACAATGTTAAATTCTGTACTCGAGTACAGAATTTAACATTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010825.3-737s21c1
Sequence:CCGGCCACGAACTATGTGATAACTTCTCGAGAAGTTATCACATAGTTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010825.3-1835s21c1
Sequence:CCGGGACGGGCTCATCGAGACAATTCTCGAGAATTGTCTCGATGAGCCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010825.2-2514s1c1
Sequence:CCGGGCACCATAAGTAGGATTCTATCTCGAGATAGAATCCTACTTATGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010825.2-803s1c1
Sequence:CCGGCCACGAACTATGTGATAACTTCTCGAGAAGTTATCACATAGTTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010825.2-827s1c1
Sequence:CCGGCCACCGGTACATTAGCTGTTTCTCGAGAAACAGCTAATGTACCGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010825.2-830s1c1
Sequence:CCGGCCGGTACATTAGCTGTTTGAACTCGAGTTCAAACAGCTAATGTACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010825.2-1659s1c1
Sequence:CCGGCCCACAATGTTAAATTCTGTACTCGAGTACAGAATTTAACATTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010825
MEIS2 MISSION shRNA shRNA Plasmid DNA
Meis homeobox 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010825.3-661s21c1
Sequence:CCGGCAAACCCAGAGCTGGATAATTCTCGAGAATTATCCAGCTCTGGGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010825.3-484s21c1
Sequence:CCGGTCTATGGGCACCCGTTGTTTCCTCGAGGAAACAACGGGTGCCCATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010825.3-1593s21c1
Sequence:CCGGCCCACAATGTTAAATTCTGTACTCGAGTACAGAATTTAACATTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010825.3-737s21c1
Sequence:CCGGCCACGAACTATGTGATAACTTCTCGAGAAGTTATCACATAGTTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010825.3-1835s21c1
Sequence:CCGGGACGGGCTCATCGAGACAATTCTCGAGAATTGTCTCGATGAGCCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010825.2-2514s1c1
Sequence:CCGGGCACCATAAGTAGGATTCTATCTCGAGATAGAATCCTACTTATGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010825.2-803s1c1
Sequence:CCGGCCACGAACTATGTGATAACTTCTCGAGAAGTTATCACATAGTTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010825.2-827s1c1
Sequence:CCGGCCACCGGTACATTAGCTGTTTCTCGAGAAACAGCTAATGTACCGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010825.2-830s1c1
Sequence:CCGGCCGGTACATTAGCTGTTTGAACTCGAGTTCAAACAGCTAATGTACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010825.2-1659s1c1
Sequence:CCGGCCCACAATGTTAAATTCTGTACTCGAGTACAGAATTTAACATTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010825
MEIS2 MISSION shRNA Lentiviral Transduction Particles
Meis homeobox 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010825.3-661s21c1
Sequence:CCGGCAAACCCAGAGCTGGATAATTCTCGAGAATTATCCAGCTCTGGGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010825.3-484s21c1
Sequence:CCGGTCTATGGGCACCCGTTGTTTCCTCGAGGAAACAACGGGTGCCCATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010825.3-1593s21c1
Sequence:CCGGCCCACAATGTTAAATTCTGTACTCGAGTACAGAATTTAACATTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010825.3-737s21c1
Sequence:CCGGCCACGAACTATGTGATAACTTCTCGAGAAGTTATCACATAGTTCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010825.3-1835s21c1
Sequence:CCGGGACGGGCTCATCGAGACAATTCTCGAGAATTGTCTCGATGAGCCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010825.2-2514s1c1
Sequence:CCGGGCACCATAAGTAGGATTCTATCTCGAGATAGAATCCTACTTATGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010825.2-803s1c1
Sequence:CCGGCCACGAACTATGTGATAACTTCTCGAGAAGTTATCACATAGTTCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010825.2-827s1c1
Sequence:CCGGCCACCGGTACATTAGCTGTTTCTCGAGAAACAGCTAATGTACCGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010825.2-830s1c1
Sequence:CCGGCCGGTACATTAGCTGTTTGAACTCGAGTTCAAACAGCTAATGTACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010825.2-1659s1c1
Sequence:CCGGCCCACAATGTTAAATTCTGTACTCGAGTACAGAATTTAACATTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002399
VALIDATED
MEIS2 MISSION shRNA Bacterial Glycerol Stock
Meis homeobox 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002399.2-635s21c1
Sequence:CCGGTCTATGGGCACCCGTTGTTTCCTCGAGGAAACAACGGGTGCCCATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002399.2-840s21c1
Sequence:CCGGACAAGCAATACAAGTACTAAGCTCGAGCTTAGTACTTGTATTGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002399.2-1405s21c1
Sequence:CCGGCCCATGATTGACCAGTCAAATCTCGAGATTTGACTGGTCAATCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002399.2-1434s21c1
Sequence:CCGGGAGCCAAGGAGCAGCATATAGCTCGAGCTATATGCTGCTCCTTGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274056    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002399.2-1710s21c1
Sequence:CCGGCCCACACCCTACTCAATTAAGCTCGAGCTTAATTGAGTAGGGTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002399.2-2450s1c1
Sequence:CCGGCGGCCTTTGTTCCTCCATAAACTCGAGTTTATGGAGGAACAAAGGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002399.2-912s1c1
Sequence:CCGGCCACCGATACATTAGCTGTTTCTCGAGAAACAGCTAATGTATCGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002399.2-1359s1c1
Sequence:CCGGCCAAGTAAACAACTGGTTTATCTCGAGATAAACCAGTTGTTTACTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002399.2-1016s1c1
Sequence:CCGGCCACAAATCTCGCTGACCATACTCGAGTATGGTCAGCGAGATTTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002399.2-1405s1c1
Sequence:CCGGCCCATGATTGACCAGTCAAATCTCGAGATTTGACTGGTCAATCATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002399
VALIDATED
MEIS2 MISSION shRNA shRNA Plasmid DNA
Meis homeobox 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002399.2-635s21c1
Sequence:CCGGTCTATGGGCACCCGTTGTTTCCTCGAGGAAACAACGGGTGCCCATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002399.2-840s21c1
Sequence:CCGGACAAGCAATACAAGTACTAAGCTCGAGCTTAGTACTTGTATTGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002399.2-1405s21c1
Sequence:CCGGCCCATGATTGACCAGTCAAATCTCGAGATTTGACTGGTCAATCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002399.2-1434s21c1
Sequence:CCGGGAGCCAAGGAGCAGCATATAGCTCGAGCTATATGCTGCTCCTTGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274056    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002399.2-1710s21c1
Sequence:CCGGCCCACACCCTACTCAATTAAGCTCGAGCTTAATTGAGTAGGGTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002399.2-2450s1c1
Sequence:CCGGCGGCCTTTGTTCCTCCATAAACTCGAGTTTATGGAGGAACAAAGGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002399.2-912s1c1
Sequence:CCGGCCACCGATACATTAGCTGTTTCTCGAGAAACAGCTAATGTATCGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002399.2-1359s1c1
Sequence:CCGGCCAAGTAAACAACTGGTTTATCTCGAGATAAACCAGTTGTTTACTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002399.2-1016s1c1
Sequence:CCGGCCACAAATCTCGCTGACCATACTCGAGTATGGTCAGCGAGATTTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002399.2-1405s1c1
Sequence:CCGGCCCATGATTGACCAGTCAAATCTCGAGATTTGACTGGTCAATCATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002399
VALIDATED
MEIS2 MISSION shRNA Lentiviral Transduction Particles
Meis homeobox 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002399.2-635s21c1
Sequence:CCGGTCTATGGGCACCCGTTGTTTCCTCGAGGAAACAACGGGTGCCCATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002399.2-840s21c1
Sequence:CCGGACAAGCAATACAAGTACTAAGCTCGAGCTTAGTACTTGTATTGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002399.2-1405s21c1
Sequence:CCGGCCCATGATTGACCAGTCAAATCTCGAGATTTGACTGGTCAATCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002399.2-1434s21c1
Sequence:CCGGGAGCCAAGGAGCAGCATATAGCTCGAGCTATATGCTGCTCCTTGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274056    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002399.2-1710s21c1
Sequence:CCGGCCCACACCCTACTCAATTAAGCTCGAGCTTAATTGAGTAGGGTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002399.2-2450s1c1
Sequence:CCGGCGGCCTTTGTTCCTCCATAAACTCGAGTTTATGGAGGAACAAAGGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002399.2-912s1c1
Sequence:CCGGCCACCGATACATTAGCTGTTTCTCGAGAAACAGCTAATGTATCGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002399.2-1359s1c1
Sequence:CCGGCCAAGTAAACAACTGGTTTATCTCGAGATAAACCAGTTGTTTACTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002399.2-1016s1c1
Sequence:CCGGCCACAAATCTCGCTGACCATACTCGAGTATGGTCAGCGAGATTTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002399.2-1405s1c1
Sequence:CCGGCCCATGATTGACCAGTCAAATCTCGAGATTTGACTGGTCAATCATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)