EMAIL THIS PAGE TO A FRIEND

MEIS3

Meis homeobox 3

111 Gene Product Result for
Synonyms: MRG2
UniProtKB ID: Q99687, A8K1N5, Q6NT73, Q8TC66, Q9NPW2
Gene ID:
Mouse(17537) Meis homeobox 3
Rat(361514) Meis homeobox 3
Zebrafish(81885) myeloid ecotropic viral integration site 3
cow(617311) Meis homeobox 3
Horse(100066050) Meis homeobox 3
domestic cat(101098101) Meis homeobox 3
dog(484421) Meis homeobox 3
naked mole-rat(101709603) Meis homeobox 3
sheep(101118811) Meis homeobox 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008627 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008627 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008627 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_085929 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_085929 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_085929 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009813 Rosetta Predictions human pricing
NM_020160 Rosetta Predictions human pricing
NM_001108472 Rosetta Predictions rat pricing
NM_008627 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077828 predicted 530
2 SASI_Hs01_00077830 predicted 1676
3 SASI_Hs02_00305688 predicted 761
4 SASI_Hs02_00305689 predicted 1883
5 SASI_Hs01_00077829 predicted 664
6 SASI_Hs01_00077831 predicted 1495
7 SASI_Hs01_00077832 predicted 1500
8 SASI_Hs01_00077833 predicted 1509
9 SASI_Hs01_00077834 predicted 1566
10 SASI_Hs01_00077835 predicted 1500
11 SASI_Hs01_00077836 predicted 1500
12 SASI_Hs01_00077837 predicted 1692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028066 predicted 530
2 SASI_Hs01_00028068 predicted 1870
3 SASI_Hs01_00028069 predicted 1676
4 SASI_Hs01_00028070 predicted 1676
5 SASI_Hs01_00028071 predicted 1698
6 SASI_Hs01_00028072 predicted 1757
7 SASI_Hs01_00028073 predicted 1687
8 SASI_Hs01_00028074 predicted 1685
9 SASI_Hs01_00028075 predicted 1878
10 SASI_Hs01_00028067 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108472 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238979 predicted 1487
2 SASI_Rn02_00238980 predicted 1108
3 SASI_Rn02_00238981 predicted 1301
4 SASI_Rn02_00238982 predicted 1313
5 SASI_Rn02_00238983 predicted 1116
6 SASI_Rn02_00238984 predicted 1151
7 SASI_Rn02_00238985 predicted 1312
8 SASI_Rn02_00238986 predicted 1521
9 SASI_Rn02_00238987 predicted 1241
10 SASI_Rn02_00238988 predicted 1517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008627 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119298 predicted 1223
2 SASI_Mm01_00119299 predicted 375
3 SASI_Mm02_00314328 predicted 1182
4 SASI_Mm01_00119300 predicted 1280
5 SASI_Mm02_00314329 predicted 209
6 SASI_Mm01_00119301 predicted 1220
7 SASI_Mm02_00314330 predicted 1048
8 SASI_Mm02_00314331 predicted 197
9 SASI_Mm01_00119304 predicted 1222
10 SASI_Mm01_00119306 predicted 486
11 SASI_Mm01_00119297 predicted 1056
12 SASI_Mm01_00119302 predicted 1253
13 SASI_Mm01_00119303 predicted 1060
14 SASI_Mm01_00119305 predicted 1468
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008627
VALIDATED
MEIS3 MISSION shRNA Bacterial Glycerol Stock
Meis homeobox 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008627.1-1455s1c1
Sequence:CCGGGCAAAGACAAAGCCTCCAGTTCTCGAGAACTGGAGGCTTTGTCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008627.1-1235s1c1
Sequence:CCGGACTTAGAAGGAGAGTGGCATTCTCGAGAATGCCACTCTCCTTCTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008627.1-585s1c1
Sequence:CCGGCCACGACCTGTGCGACAACTTCTCGAGAAGTTGTCGCACAGGTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008627.1-726s1c1
Sequence:CCGGAGACCAGAATACTACATGGATCTCGAGATCCATGTAGTATTCTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008627.2-635s21c1
Sequence:CCGGCCACGACCTGTGCGACAACTTCTCGAGAAGTTGTCGCACAGGTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008627.1-1102s1c1
Sequence:CCGGCCCATGATTGACCAGTCTAATCTCGAGATTAGACTGGTCAATCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008627.2-493s21c1
Sequence:CCGGACTCCTTCAATGAGGATATTGCTCGAGCAATATCCTCATTGAAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008627.2-1358s21c1
Sequence:CCGGCCACCAGCCTTGCACCTAATTCTCGAGAATTAGGTGCAAGGCTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008627.2-1251s21c1
Sequence:CCGGGTCAGGACACCAGGATCAATGCTCGAGCATTGATCCTGGTGTCCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008627.2-1292s21c1
Sequence:CCGGAGGAGAGTGGCATTACCTATACTCGAGTATAGGTAATGCCACTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008627
VALIDATED
MEIS3 MISSION shRNA shRNA Plasmid DNA
Meis homeobox 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008627.1-1455s1c1
Sequence:CCGGGCAAAGACAAAGCCTCCAGTTCTCGAGAACTGGAGGCTTTGTCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008627.1-1235s1c1
Sequence:CCGGACTTAGAAGGAGAGTGGCATTCTCGAGAATGCCACTCTCCTTCTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008627.1-585s1c1
Sequence:CCGGCCACGACCTGTGCGACAACTTCTCGAGAAGTTGTCGCACAGGTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008627.1-726s1c1
Sequence:CCGGAGACCAGAATACTACATGGATCTCGAGATCCATGTAGTATTCTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008627.2-635s21c1
Sequence:CCGGCCACGACCTGTGCGACAACTTCTCGAGAAGTTGTCGCACAGGTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008627.1-1102s1c1
Sequence:CCGGCCCATGATTGACCAGTCTAATCTCGAGATTAGACTGGTCAATCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008627.2-493s21c1
Sequence:CCGGACTCCTTCAATGAGGATATTGCTCGAGCAATATCCTCATTGAAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008627.2-1358s21c1
Sequence:CCGGCCACCAGCCTTGCACCTAATTCTCGAGAATTAGGTGCAAGGCTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008627.2-1251s21c1
Sequence:CCGGGTCAGGACACCAGGATCAATGCTCGAGCATTGATCCTGGTGTCCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008627.2-1292s21c1
Sequence:CCGGAGGAGAGTGGCATTACCTATACTCGAGTATAGGTAATGCCACTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008627
VALIDATED
MEIS3 MISSION shRNA Lentiviral Transduction Particles
Meis homeobox 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008627.1-1455s1c1
Sequence:CCGGGCAAAGACAAAGCCTCCAGTTCTCGAGAACTGGAGGCTTTGTCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008627.1-1235s1c1
Sequence:CCGGACTTAGAAGGAGAGTGGCATTCTCGAGAATGCCACTCTCCTTCTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008627.1-585s1c1
Sequence:CCGGCCACGACCTGTGCGACAACTTCTCGAGAAGTTGTCGCACAGGTCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008627.1-726s1c1
Sequence:CCGGAGACCAGAATACTACATGGATCTCGAGATCCATGTAGTATTCTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008627.2-635s21c1
Sequence:CCGGCCACGACCTGTGCGACAACTTCTCGAGAAGTTGTCGCACAGGTCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008627.1-1102s1c1
Sequence:CCGGCCCATGATTGACCAGTCTAATCTCGAGATTAGACTGGTCAATCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008627.2-493s21c1
Sequence:CCGGACTCCTTCAATGAGGATATTGCTCGAGCAATATCCTCATTGAAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008627.2-1358s21c1
Sequence:CCGGCCACCAGCCTTGCACCTAATTCTCGAGAATTAGGTGCAAGGCTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008627.2-1251s21c1
Sequence:CCGGGTCAGGACACCAGGATCAATGCTCGAGCATTGATCCTGGTGTCCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008627.2-1292s21c1
Sequence:CCGGAGGAGAGTGGCATTACCTATACTCGAGTATAGGTAATGCCACTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_085929
MEIS3 MISSION shRNA Bacterial Glycerol Stock
Meis homeobox 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085929.9-699s1c1
Sequence:CCGGCAATCTGATGATCCAGGCCATCTCGAGATGGCCTGGATCATCAGATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085929.9-901s1c1
Sequence:CCGGGACCAGAATAATATGTGGATTCTCGAGAATCCACATATTATTCTGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085929.9-1402s1c1
Sequence:CCGGAGTTTGAACTTGGAAGGAGAACTCGAGTTCTCCTTCCAAGTTCAAACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085929.9-517s1c1
Sequence:CCGGGCCCTGGTCTTTGAGAAATGTCTCGAGACATTTCTCAAAGACCAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085929.9-1177s1c1
Sequence:CCGGCCCTCGGAGGAGCAGAAGAAACTCGAGTTTCTTCTGCTCCTCCGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_085929
MEIS3 MISSION shRNA shRNA Plasmid DNA
Meis homeobox 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085929.9-699s1c1
Sequence:CCGGCAATCTGATGATCCAGGCCATCTCGAGATGGCCTGGATCATCAGATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085929.9-901s1c1
Sequence:CCGGGACCAGAATAATATGTGGATTCTCGAGAATCCACATATTATTCTGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085929.9-1402s1c1
Sequence:CCGGAGTTTGAACTTGGAAGGAGAACTCGAGTTCTCCTTCCAAGTTCAAACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085929.9-517s1c1
Sequence:CCGGGCCCTGGTCTTTGAGAAATGTCTCGAGACATTTCTCAAAGACCAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085929.9-1177s1c1
Sequence:CCGGCCCTCGGAGGAGCAGAAGAAACTCGAGTTTCTTCTGCTCCTCCGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_085929
MEIS3 MISSION shRNA Lentiviral Transduction Particles
Meis homeobox 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085929.9-699s1c1
Sequence:CCGGCAATCTGATGATCCAGGCCATCTCGAGATGGCCTGGATCATCAGATTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085929.9-901s1c1
Sequence:CCGGGACCAGAATAATATGTGGATTCTCGAGAATCCACATATTATTCTGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085929.9-1402s1c1
Sequence:CCGGAGTTTGAACTTGGAAGGAGAACTCGAGTTCTCCTTCCAAGTTCAAACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085929.9-517s1c1
Sequence:CCGGGCCCTGGTCTTTGAGAAATGTCTCGAGACATTTCTCAAAGACCAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085929.9-1177s1c1
Sequence:CCGGCCCTCGGAGGAGCAGAAGAAACTCGAGTTTCTTCTGCTCCTCCGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)