EMAIL THIS PAGE TO A FRIEND

MELK

maternal embryonic leucine zipper kinase

77 Gene Product Result for
Synonyms: HPK38
Gene ID:
Mouse(17279) maternal embryonic leucine zipper kinase
Rat(362510) maternal embryonic leucine zipper kinase
sheep(101108986) maternal embryonic leucine zipper kinase
naked mole-rat(101699732) maternal embryonic leucine zipper kinase
Domestic Rabbit(100349805) maternal embryonic leucine zipper kinase
domestic guinea pig(100735931) maternal embryonic leucine zipper kinase
Zebrafish(30724) maternal embryonic leucine zipper kinase
chicken(428391) maternal embryonic leucine zipper kinase
Horse(100055291) maternal embryonic leucine zipper kinase
cow(520088) maternal embryonic leucine zipper kinase
domestic cat(101099597) maternal embryonic leucine zipper kinase
dog(481608) maternal embryonic leucine zipper kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010790 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010790 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010790 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014791 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014791 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014791 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014791 siRNAs that have been validated in the lab human pricing
NM_001108662 Rosetta Predictions rat pricing
NM_010790 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014791 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210359 validated 1415
1 SASI_Hs01_00210361 validated 306
1 SASI_Hs01_00210360 validated 1261
2 SASI_Hs02_00346296 predicted 2146
3 SASI_Hs01_00210362 predicted 1910
4 SASI_Hs01_00210363 predicted 2067
5 SASI_Hs01_00210364 predicted 1796
6 SASI_Hs01_00210366 predicted 1734
7 SASI_Hs01_00210367 predicted 1464
8 SASI_Hs02_00346297 predicted 1516
9 SASI_Hs02_00346298 predicted 975
10 SASI_Hs01_00210365 predicted 1959
11 SASI_Hs01_00210368 predicted 1084
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108662 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240835 predicted 862
2 SASI_Rn02_00240836 predicted 311
3 SASI_Rn02_00240837 predicted 1286
4 SASI_Rn02_00240838 predicted 669
5 SASI_Rn02_00240839 predicted 595
6 SASI_Rn02_00240840 predicted 643
7 SASI_Rn02_00240841 predicted 1015
8 SASI_Rn02_00240842 predicted 1086
9 SASI_Rn02_00240843 predicted 1192
10 SASI_Rn02_00240844 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010790 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066784 predicted 1366
2 SASI_Mm01_00066785 predicted 1264
3 SASI_Mm01_00066786 predicted 1293
4 SASI_Mm02_00319361 predicted 858
5 SASI_Mm01_00066787 predicted 1500
6 SASI_Mm01_00066788 predicted 387
7 SASI_Mm01_00066789 predicted 1836
8 SASI_Mm01_00066790 predicted 1601
9 SASI_Mm01_00066791 predicted 1951
10 SASI_Mm01_00066792 predicted 1939
11 SASI_Mm01_00066793 predicted 1191
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010790
VALIDATED
MELK MISSION shRNA Bacterial Glycerol Stock
maternal embryonic leucine zipper kinase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010790.2-2073s1c1
Sequence:CCGGGCCTGGGTTTACAAGAGATTACTCGAGTAATCTCTTGTAAACCCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010790.2-1499s1c1
Sequence:CCGGGCCGAAGATTCCAGTTAGTAACTCGAGTTACTAACTGGAATCTTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010790.2-717s1c1
Sequence:CCGGGCAGCTCCTGAACTAATACAACTCGAGTTGTATTAGTTCAGGAGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010790.2-1287s1c1
Sequence:CCGGGCTGGATTGATAGACTATGAACTCGAGTTCATAGTCTATCAATCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010790.2-1606s1c1
Sequence:CCGGCGGTTAGAACACCAGGGAATTCTCGAGAATTCCCTGGTGTTCTAACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010790.2-931s21c1
Sequence:CCGGTGGACCCAAAGAAACGGATTTCTCGAGAAATCCGTTTCTTTGGGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010790.2-1511s21c1
Sequence:CCGGAGTTAGTAAGAACCAGTATAACTCGAGTTATACTGGTTCTTACTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010790.2-2529s21c1
Sequence:CCGGCTGTTAAGTAGAGACTATTTGCTCGAGCAAATAGTCTCTACTTAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010790.2-1406s21c1
Sequence:CCGGACGCAGAGCAGTGGCAAATAACTCGAGTTATTTGCCACTGCTCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010790.2-292s21c1
Sequence:CCGGCTGGAGAGATGGTAGCTATAACTCGAGTTATAGCTACCATCTCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010790
VALIDATED
MELK MISSION shRNA shRNA Plasmid DNA
maternal embryonic leucine zipper kinase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010790.2-2073s1c1
Sequence:CCGGGCCTGGGTTTACAAGAGATTACTCGAGTAATCTCTTGTAAACCCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010790.2-1499s1c1
Sequence:CCGGGCCGAAGATTCCAGTTAGTAACTCGAGTTACTAACTGGAATCTTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010790.2-717s1c1
Sequence:CCGGGCAGCTCCTGAACTAATACAACTCGAGTTGTATTAGTTCAGGAGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010790.2-1287s1c1
Sequence:CCGGGCTGGATTGATAGACTATGAACTCGAGTTCATAGTCTATCAATCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010790.2-1606s1c1
Sequence:CCGGCGGTTAGAACACCAGGGAATTCTCGAGAATTCCCTGGTGTTCTAACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010790.2-931s21c1
Sequence:CCGGTGGACCCAAAGAAACGGATTTCTCGAGAAATCCGTTTCTTTGGGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010790.2-1511s21c1
Sequence:CCGGAGTTAGTAAGAACCAGTATAACTCGAGTTATACTGGTTCTTACTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010790.2-2529s21c1
Sequence:CCGGCTGTTAAGTAGAGACTATTTGCTCGAGCAAATAGTCTCTACTTAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010790.2-1406s21c1
Sequence:CCGGACGCAGAGCAGTGGCAAATAACTCGAGTTATTTGCCACTGCTCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010790.2-292s21c1
Sequence:CCGGCTGGAGAGATGGTAGCTATAACTCGAGTTATAGCTACCATCTCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010790
VALIDATED
MELK MISSION shRNA Lentiviral Transduction Particles
maternal embryonic leucine zipper kinase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010790.2-2073s1c1
Sequence:CCGGGCCTGGGTTTACAAGAGATTACTCGAGTAATCTCTTGTAAACCCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010790.2-1499s1c1
Sequence:CCGGGCCGAAGATTCCAGTTAGTAACTCGAGTTACTAACTGGAATCTTCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010790.2-717s1c1
Sequence:CCGGGCAGCTCCTGAACTAATACAACTCGAGTTGTATTAGTTCAGGAGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010790.2-1287s1c1
Sequence:CCGGGCTGGATTGATAGACTATGAACTCGAGTTCATAGTCTATCAATCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010790.2-1606s1c1
Sequence:CCGGCGGTTAGAACACCAGGGAATTCTCGAGAATTCCCTGGTGTTCTAACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010790.2-931s21c1
Sequence:CCGGTGGACCCAAAGAAACGGATTTCTCGAGAAATCCGTTTCTTTGGGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010790.2-1511s21c1
Sequence:CCGGAGTTAGTAAGAACCAGTATAACTCGAGTTATACTGGTTCTTACTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010790.2-2529s21c1
Sequence:CCGGCTGTTAAGTAGAGACTATTTGCTCGAGCAAATAGTCTCTACTTAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010790.2-1406s21c1
Sequence:CCGGACGCAGAGCAGTGGCAAATAACTCGAGTTATTTGCCACTGCTCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010790.2-292s21c1
Sequence:CCGGCTGGAGAGATGGTAGCTATAACTCGAGTTATAGCTACCATCTCTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014791
VALIDATED
MELK MISSION shRNA Bacterial Glycerol Stock
maternal embryonic leucine zipper kinase
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014791.x-1052s1c1
Sequence:CCGGCAGAAACAACAGGCAAACAATCTCGAGATTGTTTGCCTGTTGTTTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014791.x-1520s1c1
Sequence:CCGGGAACCAGCATAAGAGAGAAATCTCGAGATTTCTCTCTTATGCTGGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001642    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014791.x-2409s1c1
Sequence:CCGGCTCTTAACTATGTCTCTTTGTCTCGAGACAAAGAGACATAGTTAAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014791.x-700s1c1
Sequence:CCGGCTGAGTTAATACAAGGCAAATCTCGAGATTTGCCTTGTATTAACTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014791.x-1591s1c1
Sequence:CCGGGCCTGAAAGAAACTCCAATTACTCGAGTAATTGGAGTTTCTTTCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014791.2-466s1c1
Sequence:CCGGCGGGTTGTCTTCCGTCAGATACTCGAGTATCTGACGGAAGACAACCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014791.2-2073s1c1
Sequence:CCGGCCTATCTAGCTGCAAGGTATACTCGAGTATACCTTGCAGCTAGATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014791.2-1243s1c1
Sequence:CCGGGCGGGATTAATAGACTATGATCTCGAGATCATAGTCTATTAATCCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014791.2-413s1c1
Sequence:CCGGGAGAGCTGTTTGACTATATAACTCGAGTTATATAGTCAAACAGCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014791.2-1805s1c1
Sequence:CCGGGACTAAAGCTTCACTATAATGCTCGAGCATTATAGTGAAGCTTTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_014791.2-668s21c1
Sequence:CCGGCTGAGTTAATACAAGGCAAATCTCGAGATTTGCCTTGTATTAACTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014791.2-1805s21c1
Sequence:CCGGGACTAAAGCTTCACTATAATGCTCGAGCATTATAGTGAAGCTTTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014791.2-1020s21c1
Sequence:CCGGCAGAAACAACAGGCAAACAATCTCGAGATTGTTTGCCTGTTGTTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014791.2-1559s21c1
Sequence:CCGGGCCTGAAAGAAACTCCAATTACTCGAGTAATTGGAGTTTCTTTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014791
VALIDATED
MELK MISSION shRNA shRNA Plasmid DNA
maternal embryonic leucine zipper kinase
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014791.x-1052s1c1
Sequence:CCGGCAGAAACAACAGGCAAACAATCTCGAGATTGTTTGCCTGTTGTTTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014791.x-1520s1c1
Sequence:CCGGGAACCAGCATAAGAGAGAAATCTCGAGATTTCTCTCTTATGCTGGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001642    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014791.x-2409s1c1
Sequence:CCGGCTCTTAACTATGTCTCTTTGTCTCGAGACAAAGAGACATAGTTAAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014791.x-700s1c1
Sequence:CCGGCTGAGTTAATACAAGGCAAATCTCGAGATTTGCCTTGTATTAACTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014791.x-1591s1c1
Sequence:CCGGGCCTGAAAGAAACTCCAATTACTCGAGTAATTGGAGTTTCTTTCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014791.2-466s1c1
Sequence:CCGGCGGGTTGTCTTCCGTCAGATACTCGAGTATCTGACGGAAGACAACCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014791.2-2073s1c1
Sequence:CCGGCCTATCTAGCTGCAAGGTATACTCGAGTATACCTTGCAGCTAGATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014791.2-1243s1c1
Sequence:CCGGGCGGGATTAATAGACTATGATCTCGAGATCATAGTCTATTAATCCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014791.2-413s1c1
Sequence:CCGGGAGAGCTGTTTGACTATATAACTCGAGTTATATAGTCAAACAGCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014791.2-1805s1c1
Sequence:CCGGGACTAAAGCTTCACTATAATGCTCGAGCATTATAGTGAAGCTTTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_014791.2-668s21c1
Sequence:CCGGCTGAGTTAATACAAGGCAAATCTCGAGATTTGCCTTGTATTAACTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014791.2-1805s21c1
Sequence:CCGGGACTAAAGCTTCACTATAATGCTCGAGCATTATAGTGAAGCTTTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014791.2-1020s21c1
Sequence:CCGGCAGAAACAACAGGCAAACAATCTCGAGATTGTTTGCCTGTTGTTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014791.2-1559s21c1
Sequence:CCGGGCCTGAAAGAAACTCCAATTACTCGAGTAATTGGAGTTTCTTTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014791
VALIDATED
MELK MISSION shRNA Lentiviral Transduction Particles
maternal embryonic leucine zipper kinase
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014791.x-1052s1c1
Sequence:CCGGCAGAAACAACAGGCAAACAATCTCGAGATTGTTTGCCTGTTGTTTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014791.x-1520s1c1
Sequence:CCGGGAACCAGCATAAGAGAGAAATCTCGAGATTTCTCTCTTATGCTGGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001642    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014791.x-2409s1c1
Sequence:CCGGCTCTTAACTATGTCTCTTTGTCTCGAGACAAAGAGACATAGTTAAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014791.x-700s1c1
Sequence:CCGGCTGAGTTAATACAAGGCAAATCTCGAGATTTGCCTTGTATTAACTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014791.x-1591s1c1
Sequence:CCGGGCCTGAAAGAAACTCCAATTACTCGAGTAATTGGAGTTTCTTTCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014791.2-466s1c1
Sequence:CCGGCGGGTTGTCTTCCGTCAGATACTCGAGTATCTGACGGAAGACAACCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014791.2-2073s1c1
Sequence:CCGGCCTATCTAGCTGCAAGGTATACTCGAGTATACCTTGCAGCTAGATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014791.2-1243s1c1
Sequence:CCGGGCGGGATTAATAGACTATGATCTCGAGATCATAGTCTATTAATCCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014791.2-413s1c1
Sequence:CCGGGAGAGCTGTTTGACTATATAACTCGAGTTATATAGTCAAACAGCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014791.2-1805s1c1
Sequence:CCGGGACTAAAGCTTCACTATAATGCTCGAGCATTATAGTGAAGCTTTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_014791.2-668s21c1
Sequence:CCGGCTGAGTTAATACAAGGCAAATCTCGAGATTTGCCTTGTATTAACTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014791.2-1805s21c1
Sequence:CCGGGACTAAAGCTTCACTATAATGCTCGAGCATTATAGTGAAGCTTTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014791.2-1020s21c1
Sequence:CCGGCAGAAACAACAGGCAAACAATCTCGAGATTGTTTGCCTGTTGTTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014791.2-1559s21c1
Sequence:CCGGGCCTGAAAGAAACTCCAATTACTCGAGTAATTGGAGTTTCTTTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)