EMAIL THIS PAGE TO A FRIEND

MEN1

multiple endocrine neoplasia I

129 Gene Product Result for
Synonyms: MEAI SCG2
Gene ID:
Human(4221) Summary: This gene encodes menin, a putative tumor suppressor associated with a syndrome known as multiple endocrine neoplasia type 1. In vitro studies have shown menin is localized to the nucleus, possesses two functional nuclear localization signals, and inhibits transcriptional activation by JunD, however, the function of this protein is not known. Two messages have been detected on northern blots but the larger message has not been characterized. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2008]
Mouse(17283) multiple endocrine neoplasia 1
Rat(29417) multiple endocrine neoplasia I
Zebrafish(100538227) multiple endocrine neoplasia I
Zebrafish(30130) multiple endocrine neoplasia type 1
domestic cat(692344) multiple endocrine neoplasia I
cow(539431) multiple endocrine neoplasia I
dog(483758) multiple endocrine neoplasia I
domestic guinea pig(100722977) multiple endocrine neoplasia I
naked mole-rat(101709865) multiple endocrine neoplasia I
sheep(101118395) multiple endocrine neoplasia I
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301842 Anti-MEN1 affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
SAB1300854 Anti-MEN1 (S128) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1300855 Anti-MEN1 (T594) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1400164 Anti-MEN1 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1401243 Anti-MEN1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA030342 Anti-MEN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2105270 Anti-MEN1 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, horse
western blot pricing
PLA0027 Goat anti-Menin Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. gorilla, chimpanzee, dog, pig, mouse, bovine, rat, horse, guinea pig, human, rhesus monkey, primate
immunoprecipitation (IP), proximity ligation assay, western blot pricing
PLA0032 Rabbit anti-Menin Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. bovine, primate, horse, guinea pig, mouse, rhesus monkey, human, dog, pig, rat, gorilla
immunoprecipitation (IP), proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000244 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000244 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000244 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008583 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008583 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008583 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000244 Rosetta Predictions human pricing
NM_130799 Rosetta Predictions human pricing
NM_130800 Rosetta Predictions human pricing
NM_130801 Rosetta Predictions human pricing
NM_130802 Rosetta Predictions human pricing
NM_130803 Rosetta Predictions human pricing
NM_130804 Rosetta Predictions human pricing
NM_019208 Rosetta Predictions rat pricing
NM_008583 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211239 predicted 2091
2 SASI_Hs01_00211240 predicted 1780
3 SASI_Hs01_00211241 predicted 2206
4 SASI_Hs01_00211242 predicted 818
5 SASI_Hs01_00211243 predicted 2145
6 SASI_Hs01_00211244 predicted 2331
7 SASI_Hs01_00211245 predicted 2314
8 SASI_Hs01_00211246 predicted 2081
9 SASI_Hs01_00211247 predicted 1911
10 SASI_Hs02_00302158 predicted 1210
11 SASI_Hs01_00211248 predicted 1199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130799 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062165 predicted 2083
2 SASI_Hs01_00062166 predicted 1765
3 SASI_Hs01_00062167 predicted 2189
4 SASI_Hs01_00062168 predicted 802
5 SASI_Hs01_00062169 predicted 2134
6 SASI_Hs01_00062170 predicted 2314
7 SASI_Hs01_00062171 predicted 2295
8 SASI_Hs01_00062172 predicted 2070
9 SASI_Hs01_00062173 predicted 1887
10 SASI_Hs02_00362833 predicted 1195
11 SASI_Hs01_00062174 predicted 1189
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110168 predicted 2054
2 SASI_Hs01_00110169 predicted 1745
3 SASI_Hs01_00110170 predicted 2172
4 SASI_Hs01_00110171 predicted 780
5 SASI_Hs01_00110172 predicted 2110
6 SASI_Hs01_00110173 predicted 2297
7 SASI_Hs01_00110174 predicted 2269
8 SASI_Hs01_00110175 predicted 2044
9 SASI_Hs01_00110176 predicted 1873
10 SASI_Hs02_00362834 predicted 1168
11 SASI_Hs01_00110177 predicted 1160
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143654 predicted 2045
2 SASI_Hs01_00143655 predicted 1736
3 SASI_Hs01_00143656 predicted 2159
4 SASI_Hs01_00143657 predicted 768
5 SASI_Hs01_00143658 predicted 2100
6 SASI_Hs01_00143659 predicted 2283
7 SASI_Hs01_00143660 predicted 2257
8 SASI_Hs01_00143661 predicted 2033
9 SASI_Hs01_00143662 predicted 1862
10 SASI_Hs02_00362835 predicted 1155
11 SASI_Hs01_00143663 predicted 1154
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198117 predicted 2478
2 SASI_Hs01_00198118 predicted 2175
3 SASI_Hs01_00198119 predicted 2596
4 SASI_Hs01_00198120 predicted 1197
5 SASI_Hs01_00198121 predicted 2534
6 SASI_Hs01_00198122 predicted 2718
7 SASI_Hs01_00198123 predicted 2700
8 SASI_Hs01_00198124 predicted 2469
9 SASI_Hs01_00198125 predicted 2293
10 SASI_Hs02_00362836 predicted 1590
11 SASI_Hs01_00198126 predicted 1588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130803 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040109 predicted 2491
2 SASI_Hs01_00040110 predicted 2182
3 SASI_Hs01_00040111 predicted 2603
4 SASI_Hs01_00040112 predicted 1204
5 SASI_Hs01_00040113 predicted 2542
6 SASI_Hs01_00040114 predicted 2722
7 SASI_Hs01_00040115 predicted 2700
8 SASI_Hs01_00040116 predicted 2474
9 SASI_Hs01_00040117 predicted 2298
10 SASI_Hs02_00362837 predicted 1596
11 SASI_Hs01_00040118 predicted 1592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130804 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105107 predicted 2357
2 SASI_Hs01_00105108 predicted 2049
3 SASI_Hs01_00105109 predicted 2468
4 SASI_Hs01_00105110 predicted 1076
5 SASI_Hs01_00105111 predicted 2415
6 SASI_Hs01_00105112 predicted 2593
7 SASI_Hs01_00105113 predicted 2579
8 SASI_Hs01_00105114 predicted 2352
9 SASI_Hs01_00105115 predicted 2177
10 SASI_Hs02_00362838 predicted 1474
11 SASI_Hs01_00105116 predicted 1473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019208 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068779 predicted 2284
2 SASI_Rn01_00068781 predicted 1447
3 SASI_Rn01_00068782 predicted 2227
4 SASI_Rn01_00068783 predicted 1157
5 SASI_Rn01_00068784 predicted 1094
6 SASI_Rn01_00068785 predicted 1433
7 SASI_Rn01_00068786 predicted 1470
8 SASI_Rn01_00068787 predicted 2185
9 SASI_Rn01_00068788 predicted 1156
10 SASI_Rn02_00262041 predicted 1473
11 SASI_Rn01_00068780 predicted 1089
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008583 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088602 predicted 1333
2 SASI_Mm01_00088603 predicted 1352
3 SASI_Mm01_00088604 predicted 1168
4 SASI_Mm01_00088605 predicted 2212
5 SASI_Mm01_00088606 predicted 1449
6 SASI_Mm01_00088607 predicted 1108
7 SASI_Mm02_00314218 predicted 745
8 SASI_Mm01_00088608 predicted 2308
9 SASI_Mm01_00088609 predicted 1314
10 SASI_Mm01_00088610 predicted 2074
11 SASI_Mm01_00088601 predicted 1908
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000244
VALIDATED
MEN1 MISSION shRNA Bacterial Glycerol Stock
multiple endocrine neoplasia I
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000244.2-2088s1c1
Sequence:CCGGCCGAGTACAGTCTGTATCAAACTCGAGTTTGATACAGACTGTACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000244.2-785s1c1
Sequence:CCGGGCTGTACCTGAAAGGATCATACTCGAGTATGATCCTTTCAGGTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000244.2-1364s1c1
Sequence:CCGGGCTGCGATTCTACGACGGCATCTCGAGATGCCGTCGTAGAATCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000244.2-1212s1c1
Sequence:CCGGGAGTTCTTTGAAGTAGCCAATCTCGAGATTGGCTACTTCAAAGAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000244.3-1045s21c1
Sequence:CCGGCCTCAGCCAAGACCTACTATCCTCGAGGATAGTAGGTCTTGGCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000244.3-2202s21c1
Sequence:CCGGCCTCACGCTGGGTCCTAATTACTCGAGTAATTAGGACCCAGCGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000244.3-1372s21c1
Sequence:CCGGTCTACGACGGCATCTGCAAATCTCGAGATTTGCAGATGCCGTCGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000244.3-786s21c1
Sequence:CCGGCTGTACCTGAAAGGATCATACCTCGAGGTATGATCCTTTCAGGTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000244.3-821s21c1
Sequence:CCGGCAAGATGGAGGTGGCGTTCATCTCGAGATGAACGCCACCTCCATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000244
VALIDATED
MEN1 MISSION shRNA shRNA Plasmid DNA
multiple endocrine neoplasia I
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000244.2-2088s1c1
Sequence:CCGGCCGAGTACAGTCTGTATCAAACTCGAGTTTGATACAGACTGTACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000244.2-785s1c1
Sequence:CCGGGCTGTACCTGAAAGGATCATACTCGAGTATGATCCTTTCAGGTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000244.2-1364s1c1
Sequence:CCGGGCTGCGATTCTACGACGGCATCTCGAGATGCCGTCGTAGAATCGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000244.2-1212s1c1
Sequence:CCGGGAGTTCTTTGAAGTAGCCAATCTCGAGATTGGCTACTTCAAAGAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000244.3-1045s21c1
Sequence:CCGGCCTCAGCCAAGACCTACTATCCTCGAGGATAGTAGGTCTTGGCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000244.3-2202s21c1
Sequence:CCGGCCTCACGCTGGGTCCTAATTACTCGAGTAATTAGGACCCAGCGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000244.3-1372s21c1
Sequence:CCGGTCTACGACGGCATCTGCAAATCTCGAGATTTGCAGATGCCGTCGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000244.3-786s21c1
Sequence:CCGGCTGTACCTGAAAGGATCATACCTCGAGGTATGATCCTTTCAGGTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000244.3-821s21c1
Sequence:CCGGCAAGATGGAGGTGGCGTTCATCTCGAGATGAACGCCACCTCCATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000244
VALIDATED
MEN1 MISSION shRNA Lentiviral Transduction Particles
multiple endocrine neoplasia I
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000244.2-2088s1c1
Sequence:CCGGCCGAGTACAGTCTGTATCAAACTCGAGTTTGATACAGACTGTACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000244.2-785s1c1
Sequence:CCGGGCTGTACCTGAAAGGATCATACTCGAGTATGATCCTTTCAGGTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000244.2-1364s1c1
Sequence:CCGGGCTGCGATTCTACGACGGCATCTCGAGATGCCGTCGTAGAATCGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000244.2-1212s1c1
Sequence:CCGGGAGTTCTTTGAAGTAGCCAATCTCGAGATTGGCTACTTCAAAGAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000244.3-1045s21c1
Sequence:CCGGCCTCAGCCAAGACCTACTATCCTCGAGGATAGTAGGTCTTGGCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000244.3-2202s21c1
Sequence:CCGGCCTCACGCTGGGTCCTAATTACTCGAGTAATTAGGACCCAGCGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000244.3-1372s21c1
Sequence:CCGGTCTACGACGGCATCTGCAAATCTCGAGATTTGCAGATGCCGTCGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000244.3-786s21c1
Sequence:CCGGCTGTACCTGAAAGGATCATACCTCGAGGTATGATCCTTTCAGGTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000244.3-821s21c1
Sequence:CCGGCAAGATGGAGGTGGCGTTCATCTCGAGATGAACGCCACCTCCATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008583
VALIDATED
MEN1 MISSION shRNA Bacterial Glycerol Stock
multiple endocrine neoplasia I
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008583.1-2762s1c1
Sequence:CCGGGCTCCGACTCTTATCTGTGAACTCGAGTTCACAGATAAGAGTCGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008583.1-1162s1c1
Sequence:CCGGCGATCTTCACACTGACTCTTTCTCGAGAAAGAGTCAGTGTGAAGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008583.1-1318s1c1
Sequence:CCGGCACCCTTTATCACAAGGGAATCTCGAGATTCCCTTGTGATAAAGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008583.1-2209s1c1
Sequence:CCGGCAGCGACTACACACTCTCTTTCTCGAGAAAGAGAGTGTGTAGTCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008583.1-948s1c1
Sequence:CCGGCCCTGTCTGAAGATCATGCTTCTCGAGAAGCATGATCTTCAGACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008583.1-1649s21c1
Sequence:CCGGTTTGCCCACCTGCTGCGATTTCTCGAGAAATCGCAGCAGGTGGGCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008583.1-660s21c1
Sequence:CCGGTGGCCGACCTATCCATCATTGCTCGAGCAATGATGGATAGGTCGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008583.1-1162s21c1
Sequence:CCGGCGATCTTCACACTGACTCTTTCTCGAGAAAGAGTCAGTGTGAAGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008583.1-1400s21c1
Sequence:CCGGTACCACTGTCGCAACCGAAATCTCGAGATTTCGGTTGCGACAGTGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008583.1-2697s21c1
Sequence:CCGGTACATATTGCTGCCCGAATTTCTCGAGAAATTCGGGCAGCAATATGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008583
VALIDATED
MEN1 MISSION shRNA shRNA Plasmid DNA
multiple endocrine neoplasia I
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008583.1-2762s1c1
Sequence:CCGGGCTCCGACTCTTATCTGTGAACTCGAGTTCACAGATAAGAGTCGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008583.1-1162s1c1
Sequence:CCGGCGATCTTCACACTGACTCTTTCTCGAGAAAGAGTCAGTGTGAAGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008583.1-1318s1c1
Sequence:CCGGCACCCTTTATCACAAGGGAATCTCGAGATTCCCTTGTGATAAAGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008583.1-2209s1c1
Sequence:CCGGCAGCGACTACACACTCTCTTTCTCGAGAAAGAGAGTGTGTAGTCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008583.1-948s1c1
Sequence:CCGGCCCTGTCTGAAGATCATGCTTCTCGAGAAGCATGATCTTCAGACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008583.1-1649s21c1
Sequence:CCGGTTTGCCCACCTGCTGCGATTTCTCGAGAAATCGCAGCAGGTGGGCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008583.1-660s21c1
Sequence:CCGGTGGCCGACCTATCCATCATTGCTCGAGCAATGATGGATAGGTCGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008583.1-1162s21c1
Sequence:CCGGCGATCTTCACACTGACTCTTTCTCGAGAAAGAGTCAGTGTGAAGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008583.1-1400s21c1
Sequence:CCGGTACCACTGTCGCAACCGAAATCTCGAGATTTCGGTTGCGACAGTGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008583.1-2697s21c1
Sequence:CCGGTACATATTGCTGCCCGAATTTCTCGAGAAATTCGGGCAGCAATATGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008583
VALIDATED
MEN1 MISSION shRNA Lentiviral Transduction Particles
multiple endocrine neoplasia I
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008583.1-2762s1c1
Sequence:CCGGGCTCCGACTCTTATCTGTGAACTCGAGTTCACAGATAAGAGTCGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008583.1-1162s1c1
Sequence:CCGGCGATCTTCACACTGACTCTTTCTCGAGAAAGAGTCAGTGTGAAGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008583.1-1318s1c1
Sequence:CCGGCACCCTTTATCACAAGGGAATCTCGAGATTCCCTTGTGATAAAGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008583.1-2209s1c1
Sequence:CCGGCAGCGACTACACACTCTCTTTCTCGAGAAAGAGAGTGTGTAGTCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008583.1-948s1c1
Sequence:CCGGCCCTGTCTGAAGATCATGCTTCTCGAGAAGCATGATCTTCAGACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008583.1-1649s21c1
Sequence:CCGGTTTGCCCACCTGCTGCGATTTCTCGAGAAATCGCAGCAGGTGGGCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008583.1-660s21c1
Sequence:CCGGTGGCCGACCTATCCATCATTGCTCGAGCAATGATGGATAGGTCGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008583.1-1162s21c1
Sequence:CCGGCGATCTTCACACTGACTCTTTCTCGAGAAAGAGTCAGTGTGAAGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008583.1-1400s21c1
Sequence:CCGGTACCACTGTCGCAACCGAAATCTCGAGATTTCGGTTGCGACAGTGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008583.1-2697s21c1
Sequence:CCGGTACATATTGCTGCCCGAATTTCTCGAGAAATTCGGGCAGCAATATGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)