EMAIL THIS PAGE TO A FRIEND

MEOX1

mesenchyme homeobox 1

99 Gene Product Result for
Synonyms: KFS2 MOX1
UniProtKB ID: P50221, A8MWF9, Q15069
Gene ID:
Human(4222) Summary: This gene encodes a member of a subfamily of non-clustered, diverged, antennapedia-like homeobox-containing genes. The encoded protein may play a role in the molecular signaling network regulating somite development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(17285) mesenchyme homeobox 1
Rat(363684) mesenchyme homeobox 1
Zebrafish(436723) mesenchyme homeobox 1
cow(529059) mesenchyme homeobox 1
domestic cat(101095142) mesenchyme homeobox 1
dog(607271) mesenchyme homeobox 1
chicken(395533) mesenchyme homeobox 1
sheep(101110776) mesenchyme homeobox 1
naked mole-rat(101703083) mesenchyme homeobox 1
domestic guinea pig(100723440) mesenchyme homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100268 Anti-MEOX1 (156-170) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1100267 Anti-MEOX1 (81-95) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1411960 ANTI-MEOX1 antibody produced in mouse clone 2E12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1412322 ANTI-MEOX1 antibody produced in mouse clone 1D10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412414 ANTI-MEOX1 antibody produced in mouse clone 3D6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412415 ANTI-MEOX1 antibody produced in mouse clone 1F3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1412416 ANTI-MEOX1 antibody produced in mouse clone 4E10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
AV32697 Anti-MEOX1 antibody produced in rabbit affinity isolated antibody horse, canine, bovine, guinea pig, human, rabbit
immunohistochemistry, western blot pricing
HPA045214 Anti-MEOX1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1306627 ANTI-MOX1 (MEOX1)(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1306668 ANTI-MOX1 (MEOX1)(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB3500564 Anti-MOX1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
WH0004222M1 Monoclonal Anti-MEOX1 antibody produced in mouse clone 1A10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1404071 Monoclonal Anti-MEOX1 antibody produced in mouse clone 1A12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010791 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010791 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010791 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004527 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004527 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004527 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040002 Rosetta Predictions human pricing
NM_004527 Rosetta Predictions human pricing
NM_013999 Rosetta Predictions human pricing
NM_001108837 Rosetta Predictions rat pricing
NM_010791 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040002 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080295 predicted 543
2 SASI_Hs01_00080296 predicted 400
3 SASI_Hs01_00080297 predicted 479
4 SASI_Hs01_00080298 predicted 463
5 SASI_Hs02_00308746 predicted 299
6 SASI_Hs01_00080299 predicted 318
7 SASI_Hs01_00080301 predicted 758
8 SASI_Hs01_00080302 predicted 255
9 SASI_Hs01_00080304 predicted 486
10 SASI_Hs02_00308747 predicted 889
11 SASI_Hs01_00080300 predicted 511
12 SASI_Hs01_00080303 predicted 1041
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004527 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077310 predicted 891
2 SASI_Hs01_00077311 predicted 1186
3 SASI_Hs01_00077312 predicted 696
4 SASI_Hs01_00077313 predicted 542
5 SASI_Hs01_00077314 predicted 606
6 SASI_Hs01_00077315 predicted 429
7 SASI_Hs01_00077316 predicted 441
8 SASI_Hs01_00077317 predicted 461
9 SASI_Hs02_00337823 predicted 152
10 SASI_Hs02_00337824 predicted 620
11 SASI_Hs01_00077308 predicted 1060
12 SASI_Hs01_00077309 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013999 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147554 predicted 725
2 SASI_Hs01_00147555 predicted 1015
3 SASI_Hs01_00147556 predicted 519
4 SASI_Hs01_00147558 predicted 448
5 SASI_Hs01_00147559 predicted 465
6 SASI_Hs02_00344964 predicted 521
7 SASI_Hs01_00147560 predicted 736
8 SASI_Hs01_00147561 predicted 399
9 SASI_Hs02_00344965 predicted 1002
10 SASI_Hs02_00344966 predicted 479
11 SASI_Hs01_00147552 predicted 892
12 SASI_Hs01_00147553 predicted 788
13 SASI_Hs01_00147557 predicted 437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108837 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242565 predicted 1009
2 SASI_Rn02_00242566 predicted 1175
3 SASI_Rn02_00242567 predicted 1255
4 SASI_Rn02_00242568 predicted 375
5 SASI_Rn02_00242569 predicted 550
6 SASI_Rn02_00242570 predicted 592
7 SASI_Rn02_00242571 predicted 732
8 SASI_Rn02_00242572 predicted 466
9 SASI_Rn02_00242573 predicted 531
10 SASI_Rn02_00242574 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010791 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059250 predicted 1008
2 SASI_Mm01_00059252 predicted 1265
3 SASI_Mm01_00059253 predicted 1554
4 SASI_Mm01_00059254 predicted 1225
5 SASI_Mm01_00059255 predicted 1551
6 SASI_Mm01_00059256 predicted 937
7 SASI_Mm01_00059257 predicted 1464
8 SASI_Mm01_00059258 predicted 857
9 SASI_Mm01_00059259 predicted 1524
10 SASI_Mm02_00319362 predicted 623
11 SASI_Mm01_00059251 predicted 853
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010791
MEOX1 MISSION shRNA Bacterial Glycerol Stock
mesenchyme homeobox 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010791.3-1557s21c1
Sequence:CCGGGAAGTGGCTCCTGTGTCTAAGCTCGAGCTTAGACACAGGAGCCACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010791.3-620s21c1
Sequence:CCGGGACTGGCACTTCCCTATCTCACTCGAGTGAGATAGGGAAGTGCCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010791.3-578s1c1
Sequence:CCGGCGAATCTTCAACGAGCAGCATCTCGAGATGCTGCTCGTTGAAGATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010791.3-774s1c1
Sequence:CCGGCGGAGAAGAAATCATCCAGAACTCGAGTTCTGGATGATTTCTTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010791.3-763s1c1
Sequence:CCGGCGCCAATGAGACGGAGAAGAACTCGAGTTCTTCTCCGTCTCATTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010791.3-943s1c1
Sequence:CCGGCCGGAGATATGAGATTGCAGTCTCGAGACTGCAATCTCATATCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010791.3-1012s1c1
Sequence:CCGGGAGGATGAAGTGGAAACGTGTCTCGAGACACGTTTCCACTTCATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010791
MEOX1 MISSION shRNA shRNA Plasmid DNA
mesenchyme homeobox 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010791.3-1557s21c1
Sequence:CCGGGAAGTGGCTCCTGTGTCTAAGCTCGAGCTTAGACACAGGAGCCACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010791.3-620s21c1
Sequence:CCGGGACTGGCACTTCCCTATCTCACTCGAGTGAGATAGGGAAGTGCCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010791.3-578s1c1
Sequence:CCGGCGAATCTTCAACGAGCAGCATCTCGAGATGCTGCTCGTTGAAGATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010791.3-774s1c1
Sequence:CCGGCGGAGAAGAAATCATCCAGAACTCGAGTTCTGGATGATTTCTTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010791.3-763s1c1
Sequence:CCGGCGCCAATGAGACGGAGAAGAACTCGAGTTCTTCTCCGTCTCATTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010791.3-943s1c1
Sequence:CCGGCCGGAGATATGAGATTGCAGTCTCGAGACTGCAATCTCATATCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010791.3-1012s1c1
Sequence:CCGGGAGGATGAAGTGGAAACGTGTCTCGAGACACGTTTCCACTTCATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010791
MEOX1 MISSION shRNA Lentiviral Transduction Particles
mesenchyme homeobox 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010791.3-1557s21c1
Sequence:CCGGGAAGTGGCTCCTGTGTCTAAGCTCGAGCTTAGACACAGGAGCCACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010791.3-620s21c1
Sequence:CCGGGACTGGCACTTCCCTATCTCACTCGAGTGAGATAGGGAAGTGCCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010791.3-578s1c1
Sequence:CCGGCGAATCTTCAACGAGCAGCATCTCGAGATGCTGCTCGTTGAAGATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010791.3-774s1c1
Sequence:CCGGCGGAGAAGAAATCATCCAGAACTCGAGTTCTGGATGATTTCTTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010791.3-763s1c1
Sequence:CCGGCGCCAATGAGACGGAGAAGAACTCGAGTTCTTCTCCGTCTCATTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010791.3-943s1c1
Sequence:CCGGCCGGAGATATGAGATTGCAGTCTCGAGACTGCAATCTCATATCTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010791.3-1012s1c1
Sequence:CCGGGAGGATGAAGTGGAAACGTGTCTCGAGACACGTTTCCACTTCATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004527
MEOX1 MISSION shRNA Bacterial Glycerol Stock
mesenchyme homeobox 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004527.2-1902s1c1
Sequence:CCGGGCTGTTATTGTGGGAGGAAATCTCGAGATTTCCTCCCACAATAACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004527.2-451s1c1
Sequence:CCGGCCAATGAGACAGAGAAGAAATCTCGAGATTTCTTCTCTGTCTCATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004527.2-467s1c1
Sequence:CCGGGAAATCATCCAGGCGGAGAAACTCGAGTTTCTCCGCCTGGATGATTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004527.2-152s1c1
Sequence:CCGGCCCGTTCTCCTTCCACCAGAACTCGAGTTCTGGTGGAAGGAGAACGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004527.2-627s1c1
Sequence:CCGGCGCAGATATGAGATTGCGGTACTCGAGTACCGCAATCTCATATCTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004527
MEOX1 MISSION shRNA shRNA Plasmid DNA
mesenchyme homeobox 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004527.2-1902s1c1
Sequence:CCGGGCTGTTATTGTGGGAGGAAATCTCGAGATTTCCTCCCACAATAACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004527.2-451s1c1
Sequence:CCGGCCAATGAGACAGAGAAGAAATCTCGAGATTTCTTCTCTGTCTCATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004527.2-467s1c1
Sequence:CCGGGAAATCATCCAGGCGGAGAAACTCGAGTTTCTCCGCCTGGATGATTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004527.2-152s1c1
Sequence:CCGGCCCGTTCTCCTTCCACCAGAACTCGAGTTCTGGTGGAAGGAGAACGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004527.2-627s1c1
Sequence:CCGGCGCAGATATGAGATTGCGGTACTCGAGTACCGCAATCTCATATCTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004527
MEOX1 MISSION shRNA Lentiviral Transduction Particles
mesenchyme homeobox 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004527.2-1902s1c1
Sequence:CCGGGCTGTTATTGTGGGAGGAAATCTCGAGATTTCCTCCCACAATAACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004527.2-451s1c1
Sequence:CCGGCCAATGAGACAGAGAAGAAATCTCGAGATTTCTTCTCTGTCTCATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004527.2-467s1c1
Sequence:CCGGGAAATCATCCAGGCGGAGAAACTCGAGTTTCTCCGCCTGGATGATTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004527.2-152s1c1
Sequence:CCGGCCCGTTCTCCTTCCACCAGAACTCGAGTTCTGGTGGAAGGAGAACGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004527.2-627s1c1
Sequence:CCGGCGCAGATATGAGATTGCGGTACTCGAGTACCGCAATCTCATATCTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)