EMAIL THIS PAGE TO A FRIEND

MEOX2

mesenchyme homeobox 2

150 Gene Product Result for
Synonyms: GAX MOX2
UniProtKB ID: P50222, O75263, Q9UPL6
Gene ID:
Human(4223) Summary: This gene encodes a member of a subfamily of non-clustered, diverged, antennapedia-like homeobox-containing genes. The encoded protein may play a role in the regulation of vertebrate limb myogenesis. Mutations in the related mouse protein may be associated with craniofacial and/or skeletal abnormalities, in addition to neurovascular dysfunction observed in Alzheimer's disease. [provided by RefSeq, Jul 2008]
Mouse(17286) mesenchyme homeobox 2
Rat(29279) mesenchyme homeobox 2
domestic guinea pig(100719225) mesenchyme homeobox 2
naked mole-rat(101712917) mesenchyme homeobox 2
sheep(101103559) mesenchyme homeobox 2
chicken(374137) mesenchyme homeobox 2
domestic cat(101082736) mesenchyme homeobox 2
cow(518540) mesenchyme homeobox 2
dog(482329) mesenchyme homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100060 Anti-MEOX2 (11-25) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV32698 Anti-MEOX2 (AB1) antibody produced in rabbit IgG fraction of antiserum pig, mouse, human, rabbit, bovine, dog, rat
western blot pricing
AV38700 Anti-MEOX2 (AB2) antibody produced in rabbit IgG fraction of antiserum bovine, pig, dog, rabbit, human, horse, rat, mouse
western blot pricing
AV38701 Anti-MEOX2 (AB3) antibody produced in rabbit IgG fraction of antiserum horse, bovine, human, dog, rabbit, guinea pig
western blot pricing
SAB1411961 ANTI-MEOX2 antibody produced in mouse clone 4B2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412139 ANTI-MEOX2 antibody produced in mouse clone 4E10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1412377 ANTI-MEOX2 antibody produced in mouse clone 5E1, purified immunoglobulin, buffered aqueous solution , human,
ELISA, western blot pricing
SAB1412613 ANTI-MEOX2 antibody produced in mouse clone 4D3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412614 ANTI-MEOX2 antibody produced in mouse clone 1B3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA053793 Anti-MEOX2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
SAB4501867 Anti-MEOX2 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
WH0004223M3 Monoclonal Anti-MEOX2 antibody produced in mouse clone 6A5, purified immunoglobulin, buffered aqueous solution mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404072 Monoclonal Anti-MEOX2 antibody produced in mouse clone 5A6, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005924 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005924 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005924 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008584 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008584 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008584 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005924 Rosetta Predictions human pricing
NM_017149 Rosetta Predictions rat pricing
NM_008584 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241891 predicted 840
2 SASI_Hs01_00241892 predicted 1253
3 SASI_Hs01_00241894 predicted 1232
4 SASI_Hs01_00241897 predicted 1247
5 SASI_Hs01_00241898 predicted 1006
6 SASI_Hs01_00241899 predicted 945
7 SASI_Hs01_00241900 predicted 957
8 SASI_Hs02_00340562 predicted 1264
9 SASI_Hs02_00340563 predicted 818
10 SASI_Hs02_00340564 predicted 1082
11 SASI_Hs01_00241893 predicted 858
12 SASI_Hs01_00241895 predicted 1292
13 SASI_Hs01_00241896 predicted 1249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017149 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052054 predicted 664
2 SASI_Rn01_00052055 predicted 1090
3 SASI_Rn01_00052057 predicted 731
4 SASI_Rn02_00261420 predicted 990
5 SASI_Rn02_00261421 predicted 700
6 SASI_Rn01_00052061 predicted 869
7 SASI_Rn02_00261422 predicted 743
8 SASI_Rn02_00261423 predicted 1135
9 SASI_Rn01_00052062 predicted 866
10 SASI_Rn02_00261424 predicted 832
11 SASI_Rn01_00052056 predicted 764
12 SASI_Rn01_00052058 predicted 774
13 SASI_Rn01_00052059 predicted 773
14 SASI_Rn01_00052060 predicted 772
15 SASI_Rn01_00052063 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008584 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149644 predicted 1337
2 SASI_Mm01_00149645 predicted 925
3 SASI_Mm01_00149646 predicted 792
4 SASI_Mm01_00149647 predicted 1180
5 SASI_Mm01_00149648 predicted 924
6 SASI_Mm01_00149650 predicted 1231
7 SASI_Mm01_00149651 predicted 1407
8 SASI_Mm01_00149652 predicted 893
9 SASI_Mm02_00314219 predicted 1415
10 SASI_Mm02_00314220 predicted 954
11 SASI_Mm01_00149643 predicted 824
12 SASI_Mm01_00149649 predicted 1485
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005924
MEOX2 MISSION shRNA Bacterial Glycerol Stock
mesenchyme homeobox 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005924.2-341s1c1
Sequence:CCGGCCCAACGAAGAGGGCATGTTTCTCGAGAAACATGCCCTCTTCGTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005924.4-1181s21c1
Sequence:CCGGGCATGCGCACTTATGATATAACTCGAGTTATATCATAAGTGCGCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005924.4-1087s21c1
Sequence:CCGGCATCAGAGCTGTCGGGAATTGCTCGAGCAATTCCCGACAGCTCTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005924.2-1682s1c1
Sequence:CCGGGCATTCATATTAGCTGATGAACTCGAGTTCATCAGCTAATATGAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005924.2-268s1c1
Sequence:CCGGCCATGGAAGATCTGACCATATCTCGAGATATGGTCAGATCTTCCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005924.2-853s1c1
Sequence:CCGGTCTCACTGAAAGACAGGTGAACTCGAGTTCACCTGTCTTTCAGTGAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005924.2-827s1c1
Sequence:CCGGCGATACGAGATAGCAGTGAATCTCGAGATTCACTGCTATCTCGTATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005924.4-1248s21c1
Sequence:CCGGGCCTTACCCAAATATCGTTTACTCGAGTAAACGATATTTGGGTAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005924
MEOX2 MISSION shRNA shRNA Plasmid DNA
mesenchyme homeobox 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005924.2-341s1c1
Sequence:CCGGCCCAACGAAGAGGGCATGTTTCTCGAGAAACATGCCCTCTTCGTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005924.4-1181s21c1
Sequence:CCGGGCATGCGCACTTATGATATAACTCGAGTTATATCATAAGTGCGCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005924.4-1087s21c1
Sequence:CCGGCATCAGAGCTGTCGGGAATTGCTCGAGCAATTCCCGACAGCTCTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005924.2-1682s1c1
Sequence:CCGGGCATTCATATTAGCTGATGAACTCGAGTTCATCAGCTAATATGAATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005924.2-268s1c1
Sequence:CCGGCCATGGAAGATCTGACCATATCTCGAGATATGGTCAGATCTTCCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005924.2-853s1c1
Sequence:CCGGTCTCACTGAAAGACAGGTGAACTCGAGTTCACCTGTCTTTCAGTGAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005924.2-827s1c1
Sequence:CCGGCGATACGAGATAGCAGTGAATCTCGAGATTCACTGCTATCTCGTATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005924.4-1248s21c1
Sequence:CCGGGCCTTACCCAAATATCGTTTACTCGAGTAAACGATATTTGGGTAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005924
MEOX2 MISSION shRNA Lentiviral Transduction Particles
mesenchyme homeobox 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005924.2-341s1c1
Sequence:CCGGCCCAACGAAGAGGGCATGTTTCTCGAGAAACATGCCCTCTTCGTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005924.4-1181s21c1
Sequence:CCGGGCATGCGCACTTATGATATAACTCGAGTTATATCATAAGTGCGCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005924.4-1087s21c1
Sequence:CCGGCATCAGAGCTGTCGGGAATTGCTCGAGCAATTCCCGACAGCTCTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005924.2-1682s1c1
Sequence:CCGGGCATTCATATTAGCTGATGAACTCGAGTTCATCAGCTAATATGAATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005924.2-268s1c1
Sequence:CCGGCCATGGAAGATCTGACCATATCTCGAGATATGGTCAGATCTTCCATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005924.2-853s1c1
Sequence:CCGGTCTCACTGAAAGACAGGTGAACTCGAGTTCACCTGTCTTTCAGTGAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005924.2-827s1c1
Sequence:CCGGCGATACGAGATAGCAGTGAATCTCGAGATTCACTGCTATCTCGTATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005924.4-1248s21c1
Sequence:CCGGGCCTTACCCAAATATCGTTTACTCGAGTAAACGATATTTGGGTAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008584
MEOX2 MISSION shRNA Bacterial Glycerol Stock
mesenchyme homeobox 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008584.1-917s1c1
Sequence:CCGGCTGACCAGACTGAGAAGATATCTCGAGATATCTTCTCAGTCTGGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008584.3-1188s21c1
Sequence:CCGGACACTTATGATACCTACAAAGCTCGAGCTTTGTAGGTATCATAAGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008584.1-424s1c1
Sequence:CCGGGTCTTGCATAATCGCGGGATACTCGAGTATCCCGCGATTATGCAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008584.1-809s1c1
Sequence:CCGGGAAGGAAACTACAAGTCAGAACTCGAGTTCTGACTTGTAGTTTCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008584.1-446s1c1
Sequence:CCGGCCCAACGAGGAGGGCATGTTTCTCGAGAAACATGCCCTCCTCGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008584.1-893s1c1
Sequence:CCGGGCAGAATTTGCCCATCATAATCTCGAGATTATGATGGGCAAATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008584.3-1248s21c1
Sequence:CCGGACCTTACCGAACATCGTTTACCTCGAGGTAAACGATGTTCGGTAAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431624    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008584.3-1692s21c1
Sequence:CCGGGAAATCACCAAGTGGATATAACTCGAGTTATATCCACTTGGTGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008584
MEOX2 MISSION shRNA shRNA Plasmid DNA
mesenchyme homeobox 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008584.1-917s1c1
Sequence:CCGGCTGACCAGACTGAGAAGATATCTCGAGATATCTTCTCAGTCTGGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008584.3-1188s21c1
Sequence:CCGGACACTTATGATACCTACAAAGCTCGAGCTTTGTAGGTATCATAAGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008584.1-424s1c1
Sequence:CCGGGTCTTGCATAATCGCGGGATACTCGAGTATCCCGCGATTATGCAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008584.1-809s1c1
Sequence:CCGGGAAGGAAACTACAAGTCAGAACTCGAGTTCTGACTTGTAGTTTCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008584.1-446s1c1
Sequence:CCGGCCCAACGAGGAGGGCATGTTTCTCGAGAAACATGCCCTCCTCGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008584.1-893s1c1
Sequence:CCGGGCAGAATTTGCCCATCATAATCTCGAGATTATGATGGGCAAATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008584.3-1248s21c1
Sequence:CCGGACCTTACCGAACATCGTTTACCTCGAGGTAAACGATGTTCGGTAAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431624    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008584.3-1692s21c1
Sequence:CCGGGAAATCACCAAGTGGATATAACTCGAGTTATATCCACTTGGTGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008584
MEOX2 MISSION shRNA Lentiviral Transduction Particles
mesenchyme homeobox 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008584.1-917s1c1
Sequence:CCGGCTGACCAGACTGAGAAGATATCTCGAGATATCTTCTCAGTCTGGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008584.3-1188s21c1
Sequence:CCGGACACTTATGATACCTACAAAGCTCGAGCTTTGTAGGTATCATAAGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008584.1-424s1c1
Sequence:CCGGGTCTTGCATAATCGCGGGATACTCGAGTATCCCGCGATTATGCAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008584.1-809s1c1
Sequence:CCGGGAAGGAAACTACAAGTCAGAACTCGAGTTCTGACTTGTAGTTTCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008584.1-446s1c1
Sequence:CCGGCCCAACGAGGAGGGCATGTTTCTCGAGAAACATGCCCTCCTCGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008584.1-893s1c1
Sequence:CCGGGCAGAATTTGCCCATCATAATCTCGAGATTATGATGGGCAAATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008584.3-1248s21c1
Sequence:CCGGACCTTACCGAACATCGTTTACCTCGAGGTAAACGATGTTCGGTAAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431624    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008584.3-1692s21c1
Sequence:CCGGGAAATCACCAAGTGGATATAACTCGAGTTATATCCACTTGGTGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)