EMAIL THIS PAGE TO A FRIEND

MEP1B

meprin A, beta

57 Gene Product Result for
UniProtKB ID: Q16820, B7ZM35, B9EGL6, Q670J1
Gene ID:
Human(4225) Summary: Meprins are multidomain zinc metalloproteases that are highly expressed in mammalian kidney and intestinal brush border membranes, and in leukocytes and certain cancer cells. They are involved in the hydrolysis of a variety of peptide and protein substrates, and have been implicated in cancer and intestinal inflammation. Mature meprins are oligomers of evolutionarily related, but separately encoded alpha and/or beta subunits. Homooligomers of alpha subunit are secreted, whereas, oligomers containing the beta subunit are plasma membrane-bound. This gene encodes the beta subunit. Targeted disruption of this gene in mice affects embryonic viability, renal gene expression profiles, and distribution of the membrane-associated alpha subunit in kidney and intestine. [provided by RefSeq, Oct 2011]
Mouse(17288) meprin 1 beta
Rat(25727) meprin 1 beta
Zebrafish(100151009) meprin A, beta
chicken(421097) meprin A, beta
cow(540701) meprin A, beta
Horse(100052389) meprin A, beta
domestic cat(101089149) meprin A, beta
dog(490497) meprin A, beta
naked mole-rat(101721966) meprin A, beta
sheep(101114072) meprin A, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005925 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005925 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005925 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008586 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008586 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008586 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005925 Rosetta Predictions human pricing
NM_013183 Rosetta Predictions rat pricing
NM_008586 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163166 predicted 1024
2 SASI_Hs01_00163167 predicted 1293
3 SASI_Hs01_00163168 predicted 307
4 SASI_Hs02_00340565 predicted 735
5 SASI_Hs02_00340566 predicted 1453
6 SASI_Hs01_00163170 predicted 260
7 SASI_Hs01_00163171 predicted 878
8 SASI_Hs01_00163173 predicted 1329
9 SASI_Hs01_00163174 predicted 1284
10 SASI_Hs01_00163175 predicted 626
11 SASI_Hs01_00163169 predicted 1138
12 SASI_Hs01_00163172 predicted 1235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013183 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085305 predicted 685
2 SASI_Rn02_00261017 predicted 1434
3 SASI_Rn02_00261018 predicted 1281
4 SASI_Rn01_00085307 predicted 241
5 SASI_Rn01_00085308 predicted 1329
6 SASI_Rn02_00261019 predicted 721
7 SASI_Rn01_00085309 predicted 741
8 SASI_Rn01_00085310 predicted 1586
9 SASI_Rn01_00085311 predicted 1096
10 SASI_Rn01_00085312 predicted 1469
11 SASI_Rn01_00085306 predicted 946
12 SASI_Rn01_00085313 predicted 1389
13 SASI_Rn01_00085314 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008586 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027643 predicted 764
2 SASI_Mm01_00027644 predicted 1783
3 SASI_Mm01_00027645 predicted 1603
4 SASI_Mm01_00027646 predicted 1473
5 SASI_Mm01_00027647 predicted 629
6 SASI_Mm01_00027648 predicted 780
7 SASI_Mm01_00027649 predicted 960
8 SASI_Mm02_00314222 predicted 1784
9 SASI_Mm01_00027650 predicted 1363
10 SASI_Mm01_00027651 predicted 1674
11 SASI_Mm01_00027652 predicted 689
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005925
MEP1B MISSION shRNA Bacterial Glycerol Stock
meprin A, beta
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005925.1-1326s1c1
Sequence:CCGGGCCCTCATCATATCTGGCATACTCGAGTATGCCAGATATGATGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005925.1-650s1c1
Sequence:CCGGCCCTATGATTACACTTCAGTACTCGAGTACTGAAGTGTAATCATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005925.1-1136s1c1
Sequence:CCGGGCAGACAATGTGGATGGCAATCTCGAGATTGCCATCCACATTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005925.1-1197s1c1
Sequence:CCGGGCTGGCAACTTTATCATGTAACTCGAGTTACATGATAAAGTTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005925.2-1581s21c1
Sequence:CCGGATGTCCAATCAGCGGAGTATACTCGAGTATACTCCGCTGATTGGACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005925.2-2151s21c1
Sequence:CCGGTGAAGATTAACTCGACAATATCTCGAGATATTGTCGAGTTAATCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005925.2-330s21c1
Sequence:CCGGTTTGAACGTTATCGCCTTAAACTCGAGTTTAAGGCGATAACGTTCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005925
MEP1B MISSION shRNA shRNA Plasmid DNA
meprin A, beta
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005925.1-1326s1c1
Sequence:CCGGGCCCTCATCATATCTGGCATACTCGAGTATGCCAGATATGATGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005925.1-650s1c1
Sequence:CCGGCCCTATGATTACACTTCAGTACTCGAGTACTGAAGTGTAATCATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005925.1-1136s1c1
Sequence:CCGGGCAGACAATGTGGATGGCAATCTCGAGATTGCCATCCACATTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005925.1-1197s1c1
Sequence:CCGGGCTGGCAACTTTATCATGTAACTCGAGTTACATGATAAAGTTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005925.2-1581s21c1
Sequence:CCGGATGTCCAATCAGCGGAGTATACTCGAGTATACTCCGCTGATTGGACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005925.2-2151s21c1
Sequence:CCGGTGAAGATTAACTCGACAATATCTCGAGATATTGTCGAGTTAATCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005925.2-330s21c1
Sequence:CCGGTTTGAACGTTATCGCCTTAAACTCGAGTTTAAGGCGATAACGTTCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005925
MEP1B MISSION shRNA Lentiviral Transduction Particles
meprin A, beta
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005925.1-1326s1c1
Sequence:CCGGGCCCTCATCATATCTGGCATACTCGAGTATGCCAGATATGATGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005925.1-650s1c1
Sequence:CCGGCCCTATGATTACACTTCAGTACTCGAGTACTGAAGTGTAATCATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005925.1-1136s1c1
Sequence:CCGGGCAGACAATGTGGATGGCAATCTCGAGATTGCCATCCACATTGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005925.1-1197s1c1
Sequence:CCGGGCTGGCAACTTTATCATGTAACTCGAGTTACATGATAAAGTTGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005925.2-1581s21c1
Sequence:CCGGATGTCCAATCAGCGGAGTATACTCGAGTATACTCCGCTGATTGGACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005925.2-2151s21c1
Sequence:CCGGTGAAGATTAACTCGACAATATCTCGAGATATTGTCGAGTTAATCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005925.2-330s21c1
Sequence:CCGGTTTGAACGTTATCGCCTTAAACTCGAGTTTAAGGCGATAACGTTCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008586
MEP1B MISSION shRNA Bacterial Glycerol Stock
meprin A, beta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008586.1-2024s1c1
Sequence:CCGGCCGTGTTTGCTGTGATGCTAACTCGAGTTAGCATCACAGCAAACACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008586.1-538s1c1
Sequence:CCGGCGGGATGATTACGTCATTATACTCGAGTATAATGACGTAATCATCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008586.1-1184s1c1
Sequence:CCGGGCTGGCAACTTCACTATGTAACTCGAGTTACATAGTGAAGTTGCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008586.1-705s1c1
Sequence:CCGGCGTCACGAGAATCTCAGAGTTCTCGAGAACTCTGAGATTCTCGTGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008586.1-1688s1c1
Sequence:CCGGGCAGAGGTATAGGCTATGGAACTCGAGTTCCATAGCCTATACCTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008586
MEP1B MISSION shRNA shRNA Plasmid DNA
meprin A, beta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008586.1-2024s1c1
Sequence:CCGGCCGTGTTTGCTGTGATGCTAACTCGAGTTAGCATCACAGCAAACACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008586.1-538s1c1
Sequence:CCGGCGGGATGATTACGTCATTATACTCGAGTATAATGACGTAATCATCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008586.1-1184s1c1
Sequence:CCGGGCTGGCAACTTCACTATGTAACTCGAGTTACATAGTGAAGTTGCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008586.1-705s1c1
Sequence:CCGGCGTCACGAGAATCTCAGAGTTCTCGAGAACTCTGAGATTCTCGTGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008586.1-1688s1c1
Sequence:CCGGGCAGAGGTATAGGCTATGGAACTCGAGTTCCATAGCCTATACCTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008586
MEP1B MISSION shRNA Lentiviral Transduction Particles
meprin A, beta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008586.1-2024s1c1
Sequence:CCGGCCGTGTTTGCTGTGATGCTAACTCGAGTTAGCATCACAGCAAACACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008586.1-538s1c1
Sequence:CCGGCGGGATGATTACGTCATTATACTCGAGTATAATGACGTAATCATCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008586.1-1184s1c1
Sequence:CCGGGCTGGCAACTTCACTATGTAACTCGAGTTACATAGTGAAGTTGCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008586.1-705s1c1
Sequence:CCGGCGTCACGAGAATCTCAGAGTTCTCGAGAACTCTGAGATTCTCGTGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008586.1-1688s1c1
Sequence:CCGGGCAGAGGTATAGGCTATGGAACTCGAGTTCCATAGCCTATACCTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)