EMAIL THIS PAGE TO A FRIEND

MEPCE

methylphosphate capping enzyme

112 Gene Product Result for
Synonyms: BCDIN3
UniProtKB ID: Q7L2J0, B3KP86, D6W5V7, Q9NPD4
Gene ID:
Mouse(231803) methylphosphate capping enzyme
Rat(304361) methylphosphate capping enzyme
sheep(101105971) methylphosphate capping enzyme
naked mole-rat(101720238) methylphosphate capping enzyme
Domestic Rabbit(100339554) methylphosphate capping enzyme
domestic guinea pig(100715135) methylphosphate capping enzyme
Zebrafish(561384) methylphosphate capping enzyme
domestic cat(101090162) methylphosphate capping enzyme
Horse(100068939) methylphosphate capping enzyme
cow(519969) methylphosphate capping enzyme
dog(489839) methylphosphate capping enzyme
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144913 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144913 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144913 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019606 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019606 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019606 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019606 Rosetta Predictions human pricing
XM_001067470 Rosetta Predictions rat pricing
XM_222048 Rosetta Predictions rat pricing
NM_144913 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019606 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224513 predicted 844
2 SASI_Hs01_00224514 predicted 2011
3 SASI_Hs01_00224515 predicted 2141
4 SASI_Hs01_00224516 predicted 1822
5 SASI_Hs01_00224517 predicted 1829
6 SASI_Hs01_00224519 predicted 1783
7 SASI_Hs01_00224520 predicted 828
8 SASI_Hs02_00352820 predicted 2002
9 SASI_Hs01_00224521 predicted 1574
10 SASI_Hs02_00352821 predicted 842
11 SASI_Hs01_00224518 predicted 2476
12 SASI_Hs01_00224522 predicted 1993
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067470 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321067 predicted 2607
2 SASI_Rn02_00321068 predicted 1837
3 SASI_Rn02_00321069 predicted 2319
4 SASI_Rn02_00321070 predicted 1190
5 SASI_Rn02_00321071 predicted 2307
6 SASI_Rn02_00321072 predicted 1977
7 SASI_Rn02_00321073 predicted 2066
8 SASI_Rn02_00321074 predicted 1567
9 SASI_Rn02_00321075 predicted 2529
10 SASI_Rn02_00321076 predicted 1178
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222048 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380532 predicted 2600
2 SASI_Rn02_00380533 predicted 1828
3 SASI_Rn02_00380534 predicted 2315
4 SASI_Rn02_00380535 predicted 1191
5 SASI_Rn02_00380536 predicted 2310
6 SASI_Rn02_00380537 predicted 1977
7 SASI_Rn02_00380538 predicted 2061
8 SASI_Rn02_00380539 predicted 1563
9 SASI_Rn02_00380540 predicted 2531
10 SASI_Rn02_00380541 predicted 1175
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144913 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061815 predicted 1807
2 SASI_Mm01_00061816 predicted 2099
3 SASI_Mm01_00061817 predicted 1143
4 SASI_Mm01_00061818 predicted 2692
5 SASI_Mm01_00061819 predicted 2632
6 SASI_Mm01_00061820 predicted 2435
7 SASI_Mm01_00061821 predicted 2025
8 SASI_Mm01_00061822 predicted 1531
9 SASI_Mm01_00061823 predicted 1121
10 SASI_Mm01_00061824 predicted 1324
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144913
VALIDATED
MEPCE MISSION shRNA Bacterial Glycerol Stock
methylphosphate capping enzyme
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144913.3-1095s21c1
Sequence:CCGGCGACTCTGTGTTACCATCCAACTCGAGTTGGATGGTAACACAGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144913.3-1795s21c1
Sequence:CCGGCAACAGCTAAAGTTCCAATATCTCGAGATATTGGAACTTTAGCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144913.3-1933s21c1
Sequence:CCGGGGCCATCTGACCCTAAGTATTCTCGAGAATACTTAGGGTCAGATGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144913.3-3008s21c1
Sequence:CCGGATGGACCATGGATGGACTAAGCTCGAGCTTAGTCCATCCATGGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144913.2-567s1c1
Sequence:CCGGCGACTCTGTGTTACCATCCAACTCGAGTTGGATGGTAACACAGAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144913.2-1263s1c1
Sequence:CCGGGCAACAGCTAAAGTTCCAATACTCGAGTATTGGAACTTTAGCTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144913.2-1278s1c2
Sequence:CCGGCCAATATGGGAATTACTGCAACTCGAGTTGCAGTAATTCCCATATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144913.3-2556s21c1
Sequence:CCGGGCTTGTGGCCACACCGAATAACTCGAGTTATTCGGTGTGGCCACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144913.2-1264s1c1
Sequence:CCGGCAACAGCTAAAGTTCCAATATCTCGAGATATTGGAACTTTAGCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144913
VALIDATED
MEPCE MISSION shRNA shRNA Plasmid DNA
methylphosphate capping enzyme
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144913.3-1095s21c1
Sequence:CCGGCGACTCTGTGTTACCATCCAACTCGAGTTGGATGGTAACACAGAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144913.3-1795s21c1
Sequence:CCGGCAACAGCTAAAGTTCCAATATCTCGAGATATTGGAACTTTAGCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144913.3-1933s21c1
Sequence:CCGGGGCCATCTGACCCTAAGTATTCTCGAGAATACTTAGGGTCAGATGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144913.3-3008s21c1
Sequence:CCGGATGGACCATGGATGGACTAAGCTCGAGCTTAGTCCATCCATGGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144913.2-567s1c1
Sequence:CCGGCGACTCTGTGTTACCATCCAACTCGAGTTGGATGGTAACACAGAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144913.2-1263s1c1
Sequence:CCGGGCAACAGCTAAAGTTCCAATACTCGAGTATTGGAACTTTAGCTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144913.2-1278s1c2
Sequence:CCGGCCAATATGGGAATTACTGCAACTCGAGTTGCAGTAATTCCCATATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144913.3-2556s21c1
Sequence:CCGGGCTTGTGGCCACACCGAATAACTCGAGTTATTCGGTGTGGCCACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144913.2-1264s1c1
Sequence:CCGGCAACAGCTAAAGTTCCAATATCTCGAGATATTGGAACTTTAGCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144913
VALIDATED
MEPCE MISSION shRNA Lentiviral Transduction Particles
methylphosphate capping enzyme
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144913.3-1095s21c1
Sequence:CCGGCGACTCTGTGTTACCATCCAACTCGAGTTGGATGGTAACACAGAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144913.3-1795s21c1
Sequence:CCGGCAACAGCTAAAGTTCCAATATCTCGAGATATTGGAACTTTAGCTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144913.3-1933s21c1
Sequence:CCGGGGCCATCTGACCCTAAGTATTCTCGAGAATACTTAGGGTCAGATGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144913.3-3008s21c1
Sequence:CCGGATGGACCATGGATGGACTAAGCTCGAGCTTAGTCCATCCATGGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144913.2-567s1c1
Sequence:CCGGCGACTCTGTGTTACCATCCAACTCGAGTTGGATGGTAACACAGAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144913.2-1263s1c1
Sequence:CCGGGCAACAGCTAAAGTTCCAATACTCGAGTATTGGAACTTTAGCTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144913.2-1278s1c2
Sequence:CCGGCCAATATGGGAATTACTGCAACTCGAGTTGCAGTAATTCCCATATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144913.3-2556s21c1
Sequence:CCGGGCTTGTGGCCACACCGAATAACTCGAGTTATTCGGTGTGGCCACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144913.2-1264s1c1
Sequence:CCGGCAACAGCTAAAGTTCCAATATCTCGAGATATTGGAACTTTAGCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019606
MEPCE MISSION shRNA Bacterial Glycerol Stock
methylphosphate capping enzyme
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019606.4-1773s21c1
Sequence:CCGGGTCTTCGTCACGGGTAATTATCTCGAGATAATTACCCGTGACGAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019606.4-2018s21c1
Sequence:CCGGGAACTACTACCGAATCCAATTCTCGAGAATTGGATTCGGTAGTAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019606.4-596s1c1
Sequence:CCGGCTTCAAACATCCGGCCTTCAACTCGAGTTGAAGGCCGGATGTTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019606.4-1821s1c1
Sequence:CCGGGCCCAAACACCTGAGTATGATCTCGAGATCATACTCAGGTGTTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019606.4-1348s21c1
Sequence:CCGGAGTTCCAGTATGGGAATTATTCTCGAGAATAATTCCCATACTGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019606.4-821s21c1
Sequence:CCGGTGACCCGCTCAGTCTCAATACCTCGAGGTATTGAGACTGAGCGGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019606.4-2471s21c1
Sequence:CCGGGGAGGTGGGAGGATATCAAATCTCGAGATTTGATATCCTCCCACCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019606
MEPCE MISSION shRNA shRNA Plasmid DNA
methylphosphate capping enzyme
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019606.4-1773s21c1
Sequence:CCGGGTCTTCGTCACGGGTAATTATCTCGAGATAATTACCCGTGACGAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019606.4-2018s21c1
Sequence:CCGGGAACTACTACCGAATCCAATTCTCGAGAATTGGATTCGGTAGTAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019606.4-596s1c1
Sequence:CCGGCTTCAAACATCCGGCCTTCAACTCGAGTTGAAGGCCGGATGTTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019606.4-1821s1c1
Sequence:CCGGGCCCAAACACCTGAGTATGATCTCGAGATCATACTCAGGTGTTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019606.4-1348s21c1
Sequence:CCGGAGTTCCAGTATGGGAATTATTCTCGAGAATAATTCCCATACTGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019606.4-821s21c1
Sequence:CCGGTGACCCGCTCAGTCTCAATACCTCGAGGTATTGAGACTGAGCGGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019606.4-2471s21c1
Sequence:CCGGGGAGGTGGGAGGATATCAAATCTCGAGATTTGATATCCTCCCACCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019606
MEPCE MISSION shRNA Lentiviral Transduction Particles
methylphosphate capping enzyme
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019606.4-1773s21c1
Sequence:CCGGGTCTTCGTCACGGGTAATTATCTCGAGATAATTACCCGTGACGAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019606.4-2018s21c1
Sequence:CCGGGAACTACTACCGAATCCAATTCTCGAGAATTGGATTCGGTAGTAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019606.4-596s1c1
Sequence:CCGGCTTCAAACATCCGGCCTTCAACTCGAGTTGAAGGCCGGATGTTTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019606.4-1821s1c1
Sequence:CCGGGCCCAAACACCTGAGTATGATCTCGAGATCATACTCAGGTGTTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019606.4-1348s21c1
Sequence:CCGGAGTTCCAGTATGGGAATTATTCTCGAGAATAATTCCCATACTGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019606.4-821s21c1
Sequence:CCGGTGACCCGCTCAGTCTCAATACCTCGAGGTATTGAGACTGAGCGGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019606.4-2471s21c1
Sequence:CCGGGGAGGTGGGAGGATATCAAATCTCGAGATTTGATATCCTCCCACCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)