EMAIL THIS PAGE TO A FRIEND

MEPE

matrix extracellular phosphoglycoprotein

79 Gene Product Result for
Synonyms: OF45
UniProtKB ID: Q9NQ76, A1A4X9, A8MTA3, D2CFR4, F5H5C5
Gene ID:
Mouse(94111) matrix extracellular phosphoglycoprotein with ASARM motif (bone)
Rat(79110) matrix extracellular phosphoglycoprotein
chicken(395256) matrix extracellular phosphoglycoprotein
dog(487851) matrix extracellular phosphoglycoprotein
cow(613958) matrix extracellular phosphoglycoprotein
domestic cat(100423049) matrix extracellular phosphoglycoprotein
Horse(100423048) matrix extracellular phosphoglycoprotein
domestic cat(101095010) matrix extracellular phosphoglycoprotein
domestic guinea pig(100715513) matrix extracellular phosphoglycoprotein
naked mole-rat(101705399) matrix extracellular phosphoglycoprotein
sheep(101120244) matrix extracellular phosphoglycoprotein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1581 Human MEPE ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053172 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053172 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053172 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020203 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020203 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020203 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145601 MISSION® esiRNA esiRNA human MEPE (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020203 Rosetta Predictions human pricing
NM_024142 Rosetta Predictions rat pricing
NM_053172 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020203 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135590 predicted 911
2 SASI_Hs01_00135593 predicted 1250
3 SASI_Hs01_00135594 predicted 686
4 SASI_Hs02_00353139 predicted 1478
5 SASI_Hs01_00135595 predicted 373
6 SASI_Hs02_00353140 predicted 1215
7 SASI_Hs01_00135596 predicted 305
8 SASI_Hs01_00135597 predicted 1526
9 SASI_Hs01_00135598 predicted 355
10 SASI_Hs01_00135599 predicted 979
11 SASI_Hs01_00135591 predicted 837
12 SASI_Hs01_00135592 predicted 1227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024142 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045008 predicted 515
2 SASI_Rn01_00045010 predicted 363
3 SASI_Rn01_00045011 predicted 689
4 SASI_Rn01_00045012 predicted 1152
5 SASI_Rn01_00045013 predicted 1172
6 SASI_Rn01_00045014 predicted 328
7 SASI_Rn01_00045015 predicted 1123
8 SASI_Rn01_00045016 predicted 344
9 SASI_Rn01_00045017 predicted 834
10 SASI_Rn02_00263868 predicted 697
11 SASI_Rn01_00045009 predicted 1329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053172 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190952 predicted 1064
2 SASI_Mm01_00190953 predicted 1138
3 SASI_Mm02_00337730 predicted 1203
4 SASI_Mm02_00337731 predicted 1019
5 SASI_Mm01_00190955 predicted 483
6 SASI_Mm01_00190956 predicted 1080
7 SASI_Mm01_00190957 predicted 367
8 SASI_Mm01_00190958 predicted 696
9 SASI_Mm01_00190959 predicted 908
10 SASI_Mm01_00190960 predicted 936
11 SASI_Mm01_00190954 predicted 1321
12 SASI_Mm01_00190961 predicted 1053
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053172
MEPE MISSION shRNA Bacterial Glycerol Stock
matrix extracellular phosphoglycoprotein
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053172.1-1197s21c1
Sequence:CCGGATAATCTTACACCGAATAAAGCTCGAGCTTTATTCGGTGTAAGATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053172.1-681s1c1
Sequence:CCGGGCTCCAGCAAAGCTGAAGTTACTCGAGTAACTTCAGCTTTGCTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053172.1-842s21c1
Sequence:CCGGATCACAGGCAGCACCAATTTCCTCGAGGAAATTGGTGCTGCCTGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053172.1-1369s21c1
Sequence:CCGGTGCTCTAGTCCTGGAGGAAGACTCGAGTCTTCCTCCAGGACTAGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053172.1-592s21c1
Sequence:CCGGCAGTGGAGATGGGCAACATTTCTCGAGAAATGTTGCCCATCTCCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053172.1-339s21c1
Sequence:CCGGAGAGTGTTCTAAGCGTAATTCCTCGAGGAATTACGCTTAGAACACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053172
MEPE MISSION shRNA shRNA Plasmid DNA
matrix extracellular phosphoglycoprotein
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053172.1-1197s21c1
Sequence:CCGGATAATCTTACACCGAATAAAGCTCGAGCTTTATTCGGTGTAAGATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053172.1-681s1c1
Sequence:CCGGGCTCCAGCAAAGCTGAAGTTACTCGAGTAACTTCAGCTTTGCTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053172.1-842s21c1
Sequence:CCGGATCACAGGCAGCACCAATTTCCTCGAGGAAATTGGTGCTGCCTGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053172.1-1369s21c1
Sequence:CCGGTGCTCTAGTCCTGGAGGAAGACTCGAGTCTTCCTCCAGGACTAGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053172.1-592s21c1
Sequence:CCGGCAGTGGAGATGGGCAACATTTCTCGAGAAATGTTGCCCATCTCCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053172.1-339s21c1
Sequence:CCGGAGAGTGTTCTAAGCGTAATTCCTCGAGGAATTACGCTTAGAACACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053172
MEPE MISSION shRNA Lentiviral Transduction Particles
matrix extracellular phosphoglycoprotein
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053172.1-1197s21c1
Sequence:CCGGATAATCTTACACCGAATAAAGCTCGAGCTTTATTCGGTGTAAGATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053172.1-681s1c1
Sequence:CCGGGCTCCAGCAAAGCTGAAGTTACTCGAGTAACTTCAGCTTTGCTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053172.1-842s21c1
Sequence:CCGGATCACAGGCAGCACCAATTTCCTCGAGGAAATTGGTGCTGCCTGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053172.1-1369s21c1
Sequence:CCGGTGCTCTAGTCCTGGAGGAAGACTCGAGTCTTCCTCCAGGACTAGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053172.1-592s21c1
Sequence:CCGGCAGTGGAGATGGGCAACATTTCTCGAGAAATGTTGCCCATCTCCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053172.1-339s21c1
Sequence:CCGGAGAGTGTTCTAAGCGTAATTCCTCGAGGAATTACGCTTAGAACACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020203
MEPE MISSION shRNA Bacterial Glycerol Stock
matrix extracellular phosphoglycoprotein
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020203.2-505s21c1
Sequence:CCGGGGGCCAGTGACTGCGATTAAACTCGAGTTTAATCGCAGTCACTGGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020203.1-870s1c1
Sequence:CCGGCTGACCTAGAAGGCAAAGATACTCGAGTATCTTTGCCTTCTAGGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020203.1-478s1c1
Sequence:CCGGCGCAGCTCTCATCAGAAATAACTCGAGTTATTTCTGATGAGAGCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020203.2-203s21c1
Sequence:CCGGATCAAGAGCTATCATCTAAAGCTCGAGCTTTAGATGATAGCTCTTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020203.2-1210s21c1
Sequence:CCGGGCTGAAAGTACCAACTATAATCTCGAGATTATAGTTGGTACTTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020203.1-401s1c1
Sequence:CCGGCCTAAGTCAACTGGGAATAAACTCGAGTTTATTCCCAGTTGACTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020203.1-688s1c1
Sequence:CCGGCCATCGTATTCAACACAACATCTCGAGATGTTGTGTTGAATACGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020203.1-437s1c1
Sequence:CCGGGATGATGCTATCAGCAAACTACTCGAGTAGTTTGCTGATAGCATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020203.1-279s1c1
Sequence:CCGGCCAGTGAGAATAAGGGAAGTACTCGAGTACTTCCCTTATTCTCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020203.1-268s1c1
Sequence:CCGGCCTTTCTGAAGCCAGTGAGAACTCGAGTTCTCACTGGCTTCAGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020203.1-1732s1c1
Sequence:CCGGGTGAAGAACTGAGTGAGCCAACTCGAGTTGGCTCACTCAGTTCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020203.2-1284s21c1
Sequence:CCGGTAGGAACCAAGCAACCTTAAACTCGAGTTTAAGGTTGCTTGGTTCCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020203
MEPE MISSION shRNA shRNA Plasmid DNA
matrix extracellular phosphoglycoprotein
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020203.2-505s21c1
Sequence:CCGGGGGCCAGTGACTGCGATTAAACTCGAGTTTAATCGCAGTCACTGGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020203.1-870s1c1
Sequence:CCGGCTGACCTAGAAGGCAAAGATACTCGAGTATCTTTGCCTTCTAGGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020203.1-478s1c1
Sequence:CCGGCGCAGCTCTCATCAGAAATAACTCGAGTTATTTCTGATGAGAGCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020203.2-203s21c1
Sequence:CCGGATCAAGAGCTATCATCTAAAGCTCGAGCTTTAGATGATAGCTCTTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020203.2-1210s21c1
Sequence:CCGGGCTGAAAGTACCAACTATAATCTCGAGATTATAGTTGGTACTTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020203.1-401s1c1
Sequence:CCGGCCTAAGTCAACTGGGAATAAACTCGAGTTTATTCCCAGTTGACTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020203.1-688s1c1
Sequence:CCGGCCATCGTATTCAACACAACATCTCGAGATGTTGTGTTGAATACGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020203.1-437s1c1
Sequence:CCGGGATGATGCTATCAGCAAACTACTCGAGTAGTTTGCTGATAGCATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020203.1-279s1c1
Sequence:CCGGCCAGTGAGAATAAGGGAAGTACTCGAGTACTTCCCTTATTCTCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020203.1-268s1c1
Sequence:CCGGCCTTTCTGAAGCCAGTGAGAACTCGAGTTCTCACTGGCTTCAGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020203.1-1732s1c1
Sequence:CCGGGTGAAGAACTGAGTGAGCCAACTCGAGTTGGCTCACTCAGTTCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020203.2-1284s21c1
Sequence:CCGGTAGGAACCAAGCAACCTTAAACTCGAGTTTAAGGTTGCTTGGTTCCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020203
MEPE MISSION shRNA Lentiviral Transduction Particles
matrix extracellular phosphoglycoprotein
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020203.2-505s21c1
Sequence:CCGGGGGCCAGTGACTGCGATTAAACTCGAGTTTAATCGCAGTCACTGGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020203.1-870s1c1
Sequence:CCGGCTGACCTAGAAGGCAAAGATACTCGAGTATCTTTGCCTTCTAGGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020203.1-478s1c1
Sequence:CCGGCGCAGCTCTCATCAGAAATAACTCGAGTTATTTCTGATGAGAGCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020203.2-203s21c1
Sequence:CCGGATCAAGAGCTATCATCTAAAGCTCGAGCTTTAGATGATAGCTCTTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020203.2-1210s21c1
Sequence:CCGGGCTGAAAGTACCAACTATAATCTCGAGATTATAGTTGGTACTTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020203.1-401s1c1
Sequence:CCGGCCTAAGTCAACTGGGAATAAACTCGAGTTTATTCCCAGTTGACTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020203.1-688s1c1
Sequence:CCGGCCATCGTATTCAACACAACATCTCGAGATGTTGTGTTGAATACGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020203.1-437s1c1
Sequence:CCGGGATGATGCTATCAGCAAACTACTCGAGTAGTTTGCTGATAGCATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020203.1-279s1c1
Sequence:CCGGCCAGTGAGAATAAGGGAAGTACTCGAGTACTTCCCTTATTCTCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020203.1-268s1c1
Sequence:CCGGCCTTTCTGAAGCCAGTGAGAACTCGAGTTCTCACTGGCTTCAGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020203.1-1732s1c1
Sequence:CCGGGTGAAGAACTGAGTGAGCCAACTCGAGTTGGCTCACTCAGTTCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020203.2-1284s21c1
Sequence:CCGGTAGGAACCAAGCAACCTTAAACTCGAGTTTAAGGTTGCTTGGTTCCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)