EMAIL THIS PAGE TO A FRIEND

MERTK

c-mer proto-oncogene tyrosine kinase

76 Gene Product Result for
Synonyms: MER RP38 c-mer
UniProtKB ID: Q12866, Q9HBB4
Gene ID:
Human(10461) Summary: This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
Mouse(17289) c-mer proto-oncogene tyrosine kinase
Rat(65037) c-mer proto-oncogene tyrosine kinase
Zebrafish(100322133) c-mer proto-oncogene tyrosine kinase
dog(483060) c-mer proto-oncogene tyrosine kinase
cow(504429) c-mer proto-oncogene tyrosine kinase
domestic cat(101084099) c-mer proto-oncogene tyrosine kinase
chicken(395836) c-mer proto-oncogene tyrosine kinase
sheep(101118263) c-mer proto-oncogene tyrosine kinase
naked mole-rat(101718876) c-mer proto-oncogene tyrosine kinase
domestic guinea pig(100715774) c-mer proto-oncogene tyrosine kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0712 Human MERTK / Tyrosine-protein Kinase Mer ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006343 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006343 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006343 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008587 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008587 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008587 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006343 Rosetta Predictions human pricing
NM_022943 Rosetta Predictions rat pricing
NM_008587 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114082 predicted 468
2 SASI_Hs01_00114083 predicted 1707
3 SASI_Hs01_00114084 predicted 2361
4 SASI_Hs01_00114085 predicted 2404
5 SASI_Hs01_00114086 predicted 1274
6 SASI_Hs01_00114087 predicted 624
7 SASI_Hs01_00114088 predicted 210
8 SASI_Hs01_00114089 predicted 1091
9 SASI_Hs01_00114090 predicted 984
10 SASI_Hs02_00341379 predicted 1376
11 SASI_Hs01_00114091 predicted 1863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022943 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055759 predicted 526
2 SASI_Rn01_00055760 predicted 318
3 SASI_Rn01_00055761 predicted 2307
4 SASI_Rn01_00055762 predicted 2080
5 SASI_Rn01_00055763 predicted 2780
6 SASI_Rn02_00263669 predicted 2612
7 SASI_Rn01_00055764 predicted 2633
8 SASI_Rn01_00055766 predicted 1178
9 SASI_Rn01_00055767 predicted 556
10 SASI_Rn02_00263670 predicted 578
11 SASI_Rn01_00055765 predicted 2186
12 SASI_Rn01_00055768 predicted 1484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008587 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314223 predicted 398
2 SASI_Mm01_00066964 predicted 1850
3 SASI_Mm01_00066965 predicted 3093
4 SASI_Mm01_00066966 predicted 860
5 SASI_Mm01_00066968 predicted 372
6 SASI_Mm01_00066969 predicted 2313
7 SASI_Mm01_00066970 predicted 1322
8 SASI_Mm01_00066971 predicted 705
9 SASI_Mm01_00066972 predicted 1222
10 SASI_Mm01_00066973 predicted 324
11 SASI_Mm01_00066967 predicted 2218
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006343
VALIDATED
MERTK MISSION shRNA Bacterial Glycerol Stock
c-mer proto-oncogene tyrosine kinase
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006343.2-206s21c1
Sequence:CCGGAGCCAAGCCTTACCCGCTATTCTCGAGAATAGCGGGTAAGGCTTGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006343.2-2725s1c1
Sequence:CCGGCAGACGTTATTTACGTCAATACTCGAGTATTGACGTAAATAACGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006343.2-3202s1c1
Sequence:CCGGGTATTTGTCTTCCTTACCAAGCTCGAGCTTGGTAAGGAAGACAAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006343.2-1566s1c1
Sequence:CCGGGCACACGGTTGGGTAGATTATCTCGAGATAATCTACCCAACCGTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006343.2-622s1c1
Sequence:CCGGGTTCAGACAATGGGTCGTATACTCGAGTATACGACCCATTGTCTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006343.2-2362s21c1
Sequence:CCGGAGATTTACAGTGGCGATTATTCTCGAGAATAATCGCCACTGTAAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006343.2-1105s21c1
Sequence:CCGGGTAATGGCTCAGTCATGATTTCTCGAGAAATCATGACTGAGCCATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006343.x-481s1c1
Sequence:CCGGGCTCAATCAATGTACCTAATACTCGAGTATTAGGTACATTGATTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006343.x-1809s1c1
Sequence:CCGGCGAGCCATTGAACTTACCTTACTCGAGTAAGGTAAGTTCAATGGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006343.x-2375s1c1
Sequence:CCGGGAAGATTTACAGTGGCGATTACTCGAGTAATCGCCACTGTAAATCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006343.x-2171s1c1
Sequence:CCGGCCTGCATACTTACTTACTTTACTCGAGTAAAGTAAGTAAGTATGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006343.2-466s1c1
Sequence:CCGGGCTCAATCAGTGTACCTAATACTCGAGTATTAGGTACACTGATTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006343
VALIDATED
MERTK MISSION shRNA shRNA Plasmid DNA
c-mer proto-oncogene tyrosine kinase
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006343.2-206s21c1
Sequence:CCGGAGCCAAGCCTTACCCGCTATTCTCGAGAATAGCGGGTAAGGCTTGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006343.2-2725s1c1
Sequence:CCGGCAGACGTTATTTACGTCAATACTCGAGTATTGACGTAAATAACGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006343.2-3202s1c1
Sequence:CCGGGTATTTGTCTTCCTTACCAAGCTCGAGCTTGGTAAGGAAGACAAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006343.2-1566s1c1
Sequence:CCGGGCACACGGTTGGGTAGATTATCTCGAGATAATCTACCCAACCGTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006343.2-622s1c1
Sequence:CCGGGTTCAGACAATGGGTCGTATACTCGAGTATACGACCCATTGTCTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006343.2-2362s21c1
Sequence:CCGGAGATTTACAGTGGCGATTATTCTCGAGAATAATCGCCACTGTAAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006343.2-1105s21c1
Sequence:CCGGGTAATGGCTCAGTCATGATTTCTCGAGAAATCATGACTGAGCCATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006343.x-481s1c1
Sequence:CCGGGCTCAATCAATGTACCTAATACTCGAGTATTAGGTACATTGATTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006343.x-1809s1c1
Sequence:CCGGCGAGCCATTGAACTTACCTTACTCGAGTAAGGTAAGTTCAATGGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006343.x-2375s1c1
Sequence:CCGGGAAGATTTACAGTGGCGATTACTCGAGTAATCGCCACTGTAAATCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006343.x-2171s1c1
Sequence:CCGGCCTGCATACTTACTTACTTTACTCGAGTAAAGTAAGTAAGTATGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006343.2-466s1c1
Sequence:CCGGGCTCAATCAGTGTACCTAATACTCGAGTATTAGGTACACTGATTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006343
VALIDATED
MERTK MISSION shRNA Lentiviral Transduction Particles
c-mer proto-oncogene tyrosine kinase
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006343.2-206s21c1
Sequence:CCGGAGCCAAGCCTTACCCGCTATTCTCGAGAATAGCGGGTAAGGCTTGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006343.2-2725s1c1
Sequence:CCGGCAGACGTTATTTACGTCAATACTCGAGTATTGACGTAAATAACGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006343.2-3202s1c1
Sequence:CCGGGTATTTGTCTTCCTTACCAAGCTCGAGCTTGGTAAGGAAGACAAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006343.2-1566s1c1
Sequence:CCGGGCACACGGTTGGGTAGATTATCTCGAGATAATCTACCCAACCGTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006343.2-622s1c1
Sequence:CCGGGTTCAGACAATGGGTCGTATACTCGAGTATACGACCCATTGTCTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006343.2-2362s21c1
Sequence:CCGGAGATTTACAGTGGCGATTATTCTCGAGAATAATCGCCACTGTAAATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006343.2-1105s21c1
Sequence:CCGGGTAATGGCTCAGTCATGATTTCTCGAGAAATCATGACTGAGCCATTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006343.x-481s1c1
Sequence:CCGGGCTCAATCAATGTACCTAATACTCGAGTATTAGGTACATTGATTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006343.x-1809s1c1
Sequence:CCGGCGAGCCATTGAACTTACCTTACTCGAGTAAGGTAAGTTCAATGGCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006343.x-2375s1c1
Sequence:CCGGGAAGATTTACAGTGGCGATTACTCGAGTAATCGCCACTGTAAATCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006343.x-2171s1c1
Sequence:CCGGCCTGCATACTTACTTACTTTACTCGAGTAAAGTAAGTAAGTATGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006343.2-466s1c1
Sequence:CCGGGCTCAATCAGTGTACCTAATACTCGAGTATTAGGTACACTGATTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008587
VALIDATED
MERTK MISSION shRNA Bacterial Glycerol Stock
c-mer proto-oncogene tyrosine kinase
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008587.1-3151s21c1
Sequence:CCGGGAAAGTGTTTAACTAGGTTTACTCGAGTAAACCTAGTTAAACACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008587.1-2274s21c1
Sequence:CCGGAGATTTACAGTGGTGATTATTCTCGAGAATAATCACCACTGTAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008587.1-2080s21c1
Sequence:CCGGCCTGTTATATTCCCGATTAAACTCGAGTTTAATCGGGAATATAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008587.1-302s21c1
Sequence:CCGGCTACCTCCTGTTGCGTTTAATCTCGAGATTAAACGCAACAGGAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008587.1-337s21c1
Sequence:CCGGCATAGTACTGTCGGAACATAACTCGAGTTATGTTCCGACAGTACTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008587.1-410s1c1
Sequence:CCGGGCTGGCATTTCATGGTGGAAACTCGAGTTTCCACCATGAAATGCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008587.1-131s21c1
Sequence:CCGGACCGAGCTAGATCAGCTATTTCTCGAGAAATAGCTGATCTAGCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008587.1-1672s1c1
Sequence:CCGGCGTAAATTATAGAGCGAAGAACTCGAGTTCTTCGCTCTATAATTTACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008587.1-1234s1c1
Sequence:CCGGCCTGGATATTAGATGGACGAACTCGAGTTCGTCCATCTAATATCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008587.1-2092s1c1
Sequence:CCGGCCGATTAAACACAGGACCCAACTCGAGTTGGGTCCTGTGTTTAATCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008587.1-3222s21c1
Sequence:CCGGGGAACAGCTGAGTGCTTATATCTCGAGATATAAGCACTCAGCTGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008587.1-3051s1c1
Sequence:CCGGGCATGAGAGAACCAAGCAAATCTCGAGATTTGCTTGGTTCTCTCATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008587
VALIDATED
MERTK MISSION shRNA shRNA Plasmid DNA
c-mer proto-oncogene tyrosine kinase
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008587.1-3151s21c1
Sequence:CCGGGAAAGTGTTTAACTAGGTTTACTCGAGTAAACCTAGTTAAACACTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008587.1-2274s21c1
Sequence:CCGGAGATTTACAGTGGTGATTATTCTCGAGAATAATCACCACTGTAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008587.1-2080s21c1
Sequence:CCGGCCTGTTATATTCCCGATTAAACTCGAGTTTAATCGGGAATATAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008587.1-302s21c1
Sequence:CCGGCTACCTCCTGTTGCGTTTAATCTCGAGATTAAACGCAACAGGAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008587.1-337s21c1
Sequence:CCGGCATAGTACTGTCGGAACATAACTCGAGTTATGTTCCGACAGTACTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008587.1-410s1c1
Sequence:CCGGGCTGGCATTTCATGGTGGAAACTCGAGTTTCCACCATGAAATGCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008587.1-131s21c1
Sequence:CCGGACCGAGCTAGATCAGCTATTTCTCGAGAAATAGCTGATCTAGCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008587.1-1672s1c1
Sequence:CCGGCGTAAATTATAGAGCGAAGAACTCGAGTTCTTCGCTCTATAATTTACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008587.1-1234s1c1
Sequence:CCGGCCTGGATATTAGATGGACGAACTCGAGTTCGTCCATCTAATATCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008587.1-2092s1c1
Sequence:CCGGCCGATTAAACACAGGACCCAACTCGAGTTGGGTCCTGTGTTTAATCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008587.1-3222s21c1
Sequence:CCGGGGAACAGCTGAGTGCTTATATCTCGAGATATAAGCACTCAGCTGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008587.1-3051s1c1
Sequence:CCGGGCATGAGAGAACCAAGCAAATCTCGAGATTTGCTTGGTTCTCTCATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008587
VALIDATED
MERTK MISSION shRNA Lentiviral Transduction Particles
c-mer proto-oncogene tyrosine kinase
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008587.1-3151s21c1
Sequence:CCGGGAAAGTGTTTAACTAGGTTTACTCGAGTAAACCTAGTTAAACACTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008587.1-2274s21c1
Sequence:CCGGAGATTTACAGTGGTGATTATTCTCGAGAATAATCACCACTGTAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008587.1-2080s21c1
Sequence:CCGGCCTGTTATATTCCCGATTAAACTCGAGTTTAATCGGGAATATAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008587.1-302s21c1
Sequence:CCGGCTACCTCCTGTTGCGTTTAATCTCGAGATTAAACGCAACAGGAGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008587.1-337s21c1
Sequence:CCGGCATAGTACTGTCGGAACATAACTCGAGTTATGTTCCGACAGTACTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008587.1-410s1c1
Sequence:CCGGGCTGGCATTTCATGGTGGAAACTCGAGTTTCCACCATGAAATGCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008587.1-131s21c1
Sequence:CCGGACCGAGCTAGATCAGCTATTTCTCGAGAAATAGCTGATCTAGCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008587.1-1672s1c1
Sequence:CCGGCGTAAATTATAGAGCGAAGAACTCGAGTTCTTCGCTCTATAATTTACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008587.1-1234s1c1
Sequence:CCGGCCTGGATATTAGATGGACGAACTCGAGTTCGTCCATCTAATATCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008587.1-2092s1c1
Sequence:CCGGCCGATTAAACACAGGACCCAACTCGAGTTGGGTCCTGTGTTTAATCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008587.1-3222s21c1
Sequence:CCGGGGAACAGCTGAGTGCTTATATCTCGAGATATAAGCACTCAGCTGTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008587.1-3051s1c1
Sequence:CCGGGCATGAGAGAACCAAGCAAATCTCGAGATTTGCTTGGTTCTCTCATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)