EMAIL THIS PAGE TO A FRIEND

MESDC2

mesoderm development candidate 2

53 Gene Product Result for
Synonyms: BOCA MESD
UniProtKB ID: Q14696, D3DW96, Q969U1
Gene ID:
Mouse(67943) mesoderm development candidate 2
Rat(308796) mesoderm development candidate 2
sheep(101116430) mesoderm development candidate 2
domestic guinea pig(100728269) mesoderm development candidate 2
naked mole-rat(101713356) mesoderm development candidate 2
Zebrafish(791222) mesoderm development candidate 2
chicken(415475) mesoderm development candidate 2
cow(514610) mesoderm development candidate 2
domestic cat(101094422) mesoderm development candidate 2
dog(488765) mesoderm development candidate 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0316 AQUA Peptide FIVGSD[R] African clawed frog, cow, dog, human, mouse, rat pricing
AQ0315 AQUA Peptide DGSYAWEI[K] dog, human, mouse, rat pricing
AQ0317 AQUA Peptide RPSAPVDFS[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023403 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023403 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023403 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015154 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015154 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015154 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU020501 MISSION® esiRNA esiRNA human MESDC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015154 Rosetta Predictions human pricing
NM_001008345 Rosetta Predictions rat pricing
NM_023403 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018185 predicted 1118
2 SASI_Hs01_00018187 predicted 1142
3 SASI_Hs01_00018188 predicted 1181
4 SASI_Hs01_00018189 predicted 908
5 SASI_Hs01_00018190 predicted 398
6 SASI_Hs02_00347110 predicted 419
7 SASI_Hs01_00018191 predicted 1066
8 SASI_Hs01_00018192 predicted 921
9 SASI_Hs01_00018193 predicted 370
10 SASI_Hs02_00347111 predicted 1168
11 SASI_Hs01_00018184 predicted 939
12 SASI_Hs01_00018186 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008345 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081620 predicted 1150
2 SASI_Rn01_00081621 predicted 1210
3 SASI_Rn01_00081622 predicted 1058
4 SASI_Rn01_00081624 predicted 951
5 SASI_Rn02_00199097 predicted 430
6 SASI_Rn01_00081625 predicted 1307
7 SASI_Rn01_00081626 predicted 353
8 SASI_Rn01_00081627 predicted 661
9 SASI_Rn01_00081629 predicted 1335
10 SASI_Rn02_00199098 predicted 784
11 SASI_Rn01_00081623 predicted 430
12 SASI_Rn01_00081628 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023403 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035018 predicted 928
2 SASI_Mm01_00035019 predicted 263
3 SASI_Mm01_00035020 predicted 211
4 SASI_Mm01_00035022 predicted 773
5 SASI_Mm01_00035023 predicted 818
6 SASI_Mm01_00035024 predicted 821
7 SASI_Mm01_00035025 predicted 843
8 SASI_Mm01_00035026 predicted 994
9 SASI_Mm01_00035027 predicted 324
10 SASI_Mm02_00327107 predicted 565
11 SASI_Mm01_00035021 predicted 801
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023403
VALIDATED
MESDC2 MISSION shRNA Bacterial Glycerol Stock
mesoderm development candidate 2
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023403.3-1374s21c1
Sequence:CCGGTTGTTCAGTGAGTGAAGATAACTCGAGTTATCTTCACTCACTGAACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023403.3-528s21c1
Sequence:CCGGGCACCTATCGACTTCTCAAAGCTCGAGCTTTGAGAAGTCGATAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023403.3-814s21c1
Sequence:CCGGCTCTAGAGGGACAGATGTATCCTCGAGGATACATCTGTCCCTCTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023403.3-1103s21c1
Sequence:CCGGATATCACAGTTACCGTATAAACTCGAGTTTATACGGTAACTGTGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216387    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023403.2-2780s1c1
Sequence:CCGGGAAACGAAATTGGCACATTAACTCGAGTTAATGTGCCAATTTCGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023403.2-1878s1c1
Sequence:CCGGGCTTCCAGTGATAGGTATATTCTCGAGAATATACCTATCACTGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023403.3-679s21c1
Sequence:CCGGGCCTGTTCAACGCCAACTATGCTCGAGCATAGTTGGCGTTGAACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023403.3-349s21c1
Sequence:CCGGTGTTGCTCCCTCCTCCTAATGCTCGAGCATTAGGAGGAGGGAGCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023403.2-162s1c1
Sequence:CCGGGAAGGACATCCGCGATTACAACTCGAGTTGTAATCGCGGATGTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023403.2-269s1c1
Sequence:CCGGCAGCACCTATCGACTTCTCAACTCGAGTTGAGAAGTCGATAGGTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023403.2-174s1c1
Sequence:CCGGCGATTACAACGATGCCGACATCTCGAGATGTCGGCATCGTTGTAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023403.2-661s1c1
Sequence:CCGGGCTTCCAAGGAAGACAATCGACTCGAGTCGATTGTCTTCCTTGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023403.2-438s1c1
Sequence:CCGGCTATGACGTTCAGAGGTTCATCTCGAGATGAACCTCTGAACGTCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023403.2-213s1c1
Sequence:CCGGGTGGGAGAAAGATGATGACATCTCGAGATGTCATCATCTTTCTCCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023403.2-339s1c1
Sequence:CCGGGAAGACTCTGATGATGTTTGTCTCGAGACAAACATCATCAGAGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023403
VALIDATED
MESDC2 MISSION shRNA shRNA Plasmid DNA
mesoderm development candidate 2
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023403.3-1374s21c1
Sequence:CCGGTTGTTCAGTGAGTGAAGATAACTCGAGTTATCTTCACTCACTGAACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023403.3-528s21c1
Sequence:CCGGGCACCTATCGACTTCTCAAAGCTCGAGCTTTGAGAAGTCGATAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023403.3-814s21c1
Sequence:CCGGCTCTAGAGGGACAGATGTATCCTCGAGGATACATCTGTCCCTCTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023403.3-1103s21c1
Sequence:CCGGATATCACAGTTACCGTATAAACTCGAGTTTATACGGTAACTGTGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216387    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023403.2-2780s1c1
Sequence:CCGGGAAACGAAATTGGCACATTAACTCGAGTTAATGTGCCAATTTCGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023403.2-1878s1c1
Sequence:CCGGGCTTCCAGTGATAGGTATATTCTCGAGAATATACCTATCACTGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023403.3-679s21c1
Sequence:CCGGGCCTGTTCAACGCCAACTATGCTCGAGCATAGTTGGCGTTGAACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023403.3-349s21c1
Sequence:CCGGTGTTGCTCCCTCCTCCTAATGCTCGAGCATTAGGAGGAGGGAGCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023403.2-162s1c1
Sequence:CCGGGAAGGACATCCGCGATTACAACTCGAGTTGTAATCGCGGATGTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023403.2-269s1c1
Sequence:CCGGCAGCACCTATCGACTTCTCAACTCGAGTTGAGAAGTCGATAGGTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023403.2-174s1c1
Sequence:CCGGCGATTACAACGATGCCGACATCTCGAGATGTCGGCATCGTTGTAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023403.2-661s1c1
Sequence:CCGGGCTTCCAAGGAAGACAATCGACTCGAGTCGATTGTCTTCCTTGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023403.2-438s1c1
Sequence:CCGGCTATGACGTTCAGAGGTTCATCTCGAGATGAACCTCTGAACGTCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023403.2-213s1c1
Sequence:CCGGGTGGGAGAAAGATGATGACATCTCGAGATGTCATCATCTTTCTCCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023403.2-339s1c1
Sequence:CCGGGAAGACTCTGATGATGTTTGTCTCGAGACAAACATCATCAGAGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023403
VALIDATED
MESDC2 MISSION shRNA Lentiviral Transduction Particles
mesoderm development candidate 2
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023403.3-1374s21c1
Sequence:CCGGTTGTTCAGTGAGTGAAGATAACTCGAGTTATCTTCACTCACTGAACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023403.3-528s21c1
Sequence:CCGGGCACCTATCGACTTCTCAAAGCTCGAGCTTTGAGAAGTCGATAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023403.3-814s21c1
Sequence:CCGGCTCTAGAGGGACAGATGTATCCTCGAGGATACATCTGTCCCTCTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023403.3-1103s21c1
Sequence:CCGGATATCACAGTTACCGTATAAACTCGAGTTTATACGGTAACTGTGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216387    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023403.2-2780s1c1
Sequence:CCGGGAAACGAAATTGGCACATTAACTCGAGTTAATGTGCCAATTTCGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023403.2-1878s1c1
Sequence:CCGGGCTTCCAGTGATAGGTATATTCTCGAGAATATACCTATCACTGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023403.3-679s21c1
Sequence:CCGGGCCTGTTCAACGCCAACTATGCTCGAGCATAGTTGGCGTTGAACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023403.3-349s21c1
Sequence:CCGGTGTTGCTCCCTCCTCCTAATGCTCGAGCATTAGGAGGAGGGAGCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023403.2-162s1c1
Sequence:CCGGGAAGGACATCCGCGATTACAACTCGAGTTGTAATCGCGGATGTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023403.2-269s1c1
Sequence:CCGGCAGCACCTATCGACTTCTCAACTCGAGTTGAGAAGTCGATAGGTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023403.2-174s1c1
Sequence:CCGGCGATTACAACGATGCCGACATCTCGAGATGTCGGCATCGTTGTAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023403.2-661s1c1
Sequence:CCGGGCTTCCAAGGAAGACAATCGACTCGAGTCGATTGTCTTCCTTGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023403.2-438s1c1
Sequence:CCGGCTATGACGTTCAGAGGTTCATCTCGAGATGAACCTCTGAACGTCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023403.2-213s1c1
Sequence:CCGGGTGGGAGAAAGATGATGACATCTCGAGATGTCATCATCTTTCTCCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023403.2-339s1c1
Sequence:CCGGGAAGACTCTGATGATGTTTGTCTCGAGACAAACATCATCAGAGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015154
VALIDATED
MESDC2 MISSION shRNA Bacterial Glycerol Stock
mesoderm development candidate 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015154.1-368s21c1
Sequence:CCGGAGCAAGCCTGAAAGCATATTGCTCGAGCAATATGCTTTCAGGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015154.1-507s21c1
Sequence:CCGGATGACGTCCAGAGGTTCATTGCTCGAGCAATGAACCTCTGGACGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015154.1-415s21c1
Sequence:CCGGCATGATGTTTGTCACTGTATCCTCGAGGATACAGTGACAAACATCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015154.1-342s21c1
Sequence:CCGGCTGTCGACTTCTCAAAGATAGCTCGAGCTATCTTTGAGAAGTCGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148265    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015154.1-949s1c1
Sequence:CCGGGCTTCAAGTAAGAAGACAGATCTCGAGATCTGTCTTCTTACTTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015154.1-241s1c1
Sequence:CCGGCGATTACAATGATGCAGACATCTCGAGATGTCTGCATCATTGTAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015154.1-226s1c1
Sequence:CCGGGAAGAAGGATATTCGCGATTACTCGAGTAATCGCGAATATCCTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015154.1-218s1c1
Sequence:CCGGCGGAAGAAGAAGAAGGATATTCTCGAGAATATCCTTCTTCTTCTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015154.1-542s1c1
Sequence:CCGGGCTATCTTCATGCTTCGCGATCTCGAGATCGCGAAGCATGAAGATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015154.1-2401s1c1
Sequence:CCGGGCCCAGTATAAAGCAGCTGTTCTCGAGAACAGCTGCTTTATACTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015154
VALIDATED
MESDC2 MISSION shRNA shRNA Plasmid DNA
mesoderm development candidate 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015154.1-368s21c1
Sequence:CCGGAGCAAGCCTGAAAGCATATTGCTCGAGCAATATGCTTTCAGGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015154.1-507s21c1
Sequence:CCGGATGACGTCCAGAGGTTCATTGCTCGAGCAATGAACCTCTGGACGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015154.1-415s21c1
Sequence:CCGGCATGATGTTTGTCACTGTATCCTCGAGGATACAGTGACAAACATCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015154.1-342s21c1
Sequence:CCGGCTGTCGACTTCTCAAAGATAGCTCGAGCTATCTTTGAGAAGTCGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148265    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015154.1-949s1c1
Sequence:CCGGGCTTCAAGTAAGAAGACAGATCTCGAGATCTGTCTTCTTACTTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015154.1-241s1c1
Sequence:CCGGCGATTACAATGATGCAGACATCTCGAGATGTCTGCATCATTGTAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015154.1-226s1c1
Sequence:CCGGGAAGAAGGATATTCGCGATTACTCGAGTAATCGCGAATATCCTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015154.1-218s1c1
Sequence:CCGGCGGAAGAAGAAGAAGGATATTCTCGAGAATATCCTTCTTCTTCTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015154.1-542s1c1
Sequence:CCGGGCTATCTTCATGCTTCGCGATCTCGAGATCGCGAAGCATGAAGATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015154.1-2401s1c1
Sequence:CCGGGCCCAGTATAAAGCAGCTGTTCTCGAGAACAGCTGCTTTATACTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015154
VALIDATED
MESDC2 MISSION shRNA Lentiviral Transduction Particles
mesoderm development candidate 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015154.1-368s21c1
Sequence:CCGGAGCAAGCCTGAAAGCATATTGCTCGAGCAATATGCTTTCAGGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015154.1-507s21c1
Sequence:CCGGATGACGTCCAGAGGTTCATTGCTCGAGCAATGAACCTCTGGACGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015154.1-415s21c1
Sequence:CCGGCATGATGTTTGTCACTGTATCCTCGAGGATACAGTGACAAACATCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015154.1-342s21c1
Sequence:CCGGCTGTCGACTTCTCAAAGATAGCTCGAGCTATCTTTGAGAAGTCGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148265    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015154.1-949s1c1
Sequence:CCGGGCTTCAAGTAAGAAGACAGATCTCGAGATCTGTCTTCTTACTTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015154.1-241s1c1
Sequence:CCGGCGATTACAATGATGCAGACATCTCGAGATGTCTGCATCATTGTAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015154.1-226s1c1
Sequence:CCGGGAAGAAGGATATTCGCGATTACTCGAGTAATCGCGAATATCCTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015154.1-218s1c1
Sequence:CCGGCGGAAGAAGAAGAAGGATATTCTCGAGAATATCCTTCTTCTTCTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015154.1-542s1c1
Sequence:CCGGGCTATCTTCATGCTTCGCGATCTCGAGATCGCGAAGCATGAAGATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015154.1-2401s1c1
Sequence:CCGGGCCCAGTATAAAGCAGCTGTTCTCGAGAACAGCTGCTTTATACTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)