EMAIL THIS PAGE TO A FRIEND

MESP1

mesoderm posterior 1 homolog (mouse)

49 Gene Product Result for
Synonyms: bHLHc5
UniProtKB ID: Q9BRJ9, Q9NSF1, Q9NSF2
Gene ID:
Mouse(17292) mesoderm posterior 1
Rat(308766) mesoderm posterior 1 homolog (mouse)
Zebrafish(114419) mesoderm posterior 1
domestic cat(101089867) mesoderm posterior 1 homolog (mouse)
dog(609324) mesoderm posterior 1 homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018670 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018670 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018670 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008588 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008588 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008588 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018670 Rosetta Predictions human pricing
NM_001107531 Rosetta Predictions rat pricing
NM_008588 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352185 predicted 869
2 SASI_Hs01_00057759 predicted 809
3 SASI_Hs01_00057760 predicted 456
4 SASI_Hs01_00057761 predicted 457
5 SASI_Hs01_00057762 predicted 893
6 SASI_Hs01_00057763 predicted 811
7 SASI_Hs01_00057764 predicted 897
8 SASI_Hs01_00057765 predicted 914
9 SASI_Hs01_00057766 predicted 726
10 SASI_Hs01_00057767 predicted 730
11 SASI_Hs01_00057768 predicted 737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107531 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229745 predicted 939
2 SASI_Rn02_00229746 predicted 986
3 SASI_Rn02_00229747 predicted 837
4 SASI_Rn02_00229748 predicted 982
5 SASI_Rn02_00229749 predicted 997
6 SASI_Rn02_00229750 predicted 574
7 SASI_Rn02_00229751 predicted 991
8 SASI_Rn02_00229752 predicted 857
9 SASI_Rn02_00229753 predicted 849
10 SASI_Rn02_00229754 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008588 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128816 predicted 759
2 SASI_Mm01_00128817 predicted 284
3 SASI_Mm01_00128818 predicted 828
4 SASI_Mm01_00128819 predicted 835
5 SASI_Mm01_00128820 predicted 832
6 SASI_Mm01_00128821 predicted 712
7 SASI_Mm01_00128822 predicted 752
8 SASI_Mm01_00128823 predicted 570
9 SASI_Mm01_00128824 predicted 750
10 SASI_Mm01_00128825 predicted 673
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018670
VALIDATED
MESP1 MISSION shRNA Bacterial Glycerol Stock
mesoderm posterior 1 homolog (mouse)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018670.1-598s1c1
Sequence:CCGGCCGCGCAGATGCAGACACGGACTCGAGTCCGTGTCTGCATCTGCGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018670.1-831s1c1
Sequence:CCGGGCTCTGTTGGAGACCTGGATGCTCGAGCATCCAGGTCTCCAACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018670.1-780s1c1
Sequence:CCGGCAGGCGATGGAGCCAAGCCCACTCGAGTGGGCTTGGCTCCATCGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018670.1-854s1c1
Sequence:CCGGCCTCTCGCCTCTGGAGTGGCTCTCGAGAGCCACTCCAGAGGCGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018670.1-114s1c1
Sequence:CCGGTCCGAGTCCTGGATGCTCTCTCTCGAGAGAGAGCATCCAGGACTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018670.3-877s21c1
Sequence:CCGGCCCAAGTGACAAGGGACAACTCTCGAGAGTTGTCCCTTGTCACTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018670.3-891s21c1
Sequence:CCGGGACAACTGACGCCGTCTCTGTCTCGAGACAGAGACGGCGTCAGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018670.3-941s21c1
Sequence:CCGGTTCGAAGTGGTTCCTTGGCAGCTCGAGCTGCCAAGGAACCACTTCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018670
VALIDATED
MESP1 MISSION shRNA shRNA Plasmid DNA
mesoderm posterior 1 homolog (mouse)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018670.1-598s1c1
Sequence:CCGGCCGCGCAGATGCAGACACGGACTCGAGTCCGTGTCTGCATCTGCGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018670.1-831s1c1
Sequence:CCGGGCTCTGTTGGAGACCTGGATGCTCGAGCATCCAGGTCTCCAACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018670.1-780s1c1
Sequence:CCGGCAGGCGATGGAGCCAAGCCCACTCGAGTGGGCTTGGCTCCATCGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018670.1-854s1c1
Sequence:CCGGCCTCTCGCCTCTGGAGTGGCTCTCGAGAGCCACTCCAGAGGCGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018670.1-114s1c1
Sequence:CCGGTCCGAGTCCTGGATGCTCTCTCTCGAGAGAGAGCATCCAGGACTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018670.3-877s21c1
Sequence:CCGGCCCAAGTGACAAGGGACAACTCTCGAGAGTTGTCCCTTGTCACTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018670.3-891s21c1
Sequence:CCGGGACAACTGACGCCGTCTCTGTCTCGAGACAGAGACGGCGTCAGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018670.3-941s21c1
Sequence:CCGGTTCGAAGTGGTTCCTTGGCAGCTCGAGCTGCCAAGGAACCACTTCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018670
VALIDATED
MESP1 MISSION shRNA Lentiviral Transduction Particles
mesoderm posterior 1 homolog (mouse)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018670.1-598s1c1
Sequence:CCGGCCGCGCAGATGCAGACACGGACTCGAGTCCGTGTCTGCATCTGCGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018670.1-831s1c1
Sequence:CCGGGCTCTGTTGGAGACCTGGATGCTCGAGCATCCAGGTCTCCAACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018670.1-780s1c1
Sequence:CCGGCAGGCGATGGAGCCAAGCCCACTCGAGTGGGCTTGGCTCCATCGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018670.1-854s1c1
Sequence:CCGGCCTCTCGCCTCTGGAGTGGCTCTCGAGAGCCACTCCAGAGGCGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018670.1-114s1c1
Sequence:CCGGTCCGAGTCCTGGATGCTCTCTCTCGAGAGAGAGCATCCAGGACTCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018670.3-877s21c1
Sequence:CCGGCCCAAGTGACAAGGGACAACTCTCGAGAGTTGTCCCTTGTCACTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018670.3-891s21c1
Sequence:CCGGGACAACTGACGCCGTCTCTGTCTCGAGACAGAGACGGCGTCAGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018670.3-941s21c1
Sequence:CCGGTTCGAAGTGGTTCCTTGGCAGCTCGAGCTGCCAAGGAACCACTTCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008588
MESP1 MISSION shRNA Bacterial Glycerol Stock
mesoderm posterior 1 homolog (mouse)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096554    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008588.1-962s1c1
Sequence:CCGGCCTCATCCAGACTGTACCATTCTCGAGAATGGTACAGTCTGGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008588.1-696s1c1
Sequence:CCGGCAGAAACAGCATCCCAGGAAACTCGAGTTTCCTGGGATGCTGTTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008588.1-403s1c1
Sequence:CCGGCGTGGCACCAACCGGCCAGAACTCGAGTTCTGGCCGGTTGGTGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008588.1-579s1c1
Sequence:CCGGAGTCACTCGGTCCTGGTTTAACTCGAGTTAAACCAGGACCGAGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008588.1-680s1c1
Sequence:CCGGCCATCGTTCCAGTACGCAGAACTCGAGTTCTGCGTACTGGAACGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008588
MESP1 MISSION shRNA shRNA Plasmid DNA
mesoderm posterior 1 homolog (mouse)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096554    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008588.1-962s1c1
Sequence:CCGGCCTCATCCAGACTGTACCATTCTCGAGAATGGTACAGTCTGGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008588.1-696s1c1
Sequence:CCGGCAGAAACAGCATCCCAGGAAACTCGAGTTTCCTGGGATGCTGTTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008588.1-403s1c1
Sequence:CCGGCGTGGCACCAACCGGCCAGAACTCGAGTTCTGGCCGGTTGGTGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008588.1-579s1c1
Sequence:CCGGAGTCACTCGGTCCTGGTTTAACTCGAGTTAAACCAGGACCGAGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008588.1-680s1c1
Sequence:CCGGCCATCGTTCCAGTACGCAGAACTCGAGTTCTGCGTACTGGAACGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008588
MESP1 MISSION shRNA Lentiviral Transduction Particles
mesoderm posterior 1 homolog (mouse)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096554    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008588.1-962s1c1
Sequence:CCGGCCTCATCCAGACTGTACCATTCTCGAGAATGGTACAGTCTGGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008588.1-696s1c1
Sequence:CCGGCAGAAACAGCATCCCAGGAAACTCGAGTTTCCTGGGATGCTGTTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008588.1-403s1c1
Sequence:CCGGCGTGGCACCAACCGGCCAGAACTCGAGTTCTGGCCGGTTGGTGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008588.1-579s1c1
Sequence:CCGGAGTCACTCGGTCCTGGTTTAACTCGAGTTAAACCAGGACCGAGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008588.1-680s1c1
Sequence:CCGGCCATCGTTCCAGTACGCAGAACTCGAGTTCTGCGTACTGGAACGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)