EMAIL THIS PAGE TO A FRIEND

MESP2

mesoderm posterior 2 homolog (mouse)

68 Gene Product Result for
Synonyms: SCDO2 bHLHc6
UniProtKB ID: Q0VG99, Q7RTU2
Gene ID:
Human(145873) Summary: This gene encodes a member of the bHLH family of transcription factors and plays a key role in defining the rostrocaudal patterning of somites via interactions with multiple Notch signaling pathways. This gene is expressed in the anterior presomitic mesoderm and is downregulated immediately after the formation of segmented somites. This gene also plays a role in the formation of epithelial somitic mesoderm and cardiac mesoderm. Mutations in the MESP2 gene cause autosomal recessive spondylocostal dystosis 2 (SCD02). [provided by RefSeq, Oct 2008]
Mouse(17293) mesoderm posterior 2
Rat(293046) mesoderm posterior 2 homolog (mouse)
sheep(101102093) mesoderm posterior 2 homolog (mouse)
domestic guinea pig(100729192) mesoderm posterior 2 homolog (mouse)
naked mole-rat(101705671) mesoderm posterior 2 homolog (mouse)
chicken(395252) mesoderm posterior 2 homolog (mouse)
cow(615145) mesoderm posterior 2 homolog (mouse)
chicken(768345) mesoderm posterior 2 homolog (mouse)
dog(100683170) mesoderm posterior 2 homolog (mouse)
domestic cat(101089615) mesoderm posterior 2 homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008589 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008589 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008589 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_085261 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_085261 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_085261 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU090641 MISSION® esiRNA esiRNA targeting mouse Mesp2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039958 Rosetta Predictions human pricing
NM_001106273 Rosetta Predictions rat pricing
NM_008589 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039958 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036786 predicted 1245
2 SASI_Hs01_00036787 predicted 1318
3 SASI_Hs01_00036789 predicted 1325
4 SASI_Hs01_00036790 predicted 1340
5 SASI_Hs02_00308731 predicted 1203
6 SASI_Hs01_00036791 predicted 204
7 SASI_Hs01_00036792 predicted 1215
8 SASI_Hs01_00036793 predicted 1312
9 SASI_Hs01_00036794 predicted 978
10 SASI_Hs01_00036795 predicted 1237
11 SASI_Hs01_00036788 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106273 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217348 predicted 785
2 SASI_Rn02_00217349 predicted 1359
3 SASI_Rn02_00217350 predicted 816
4 SASI_Rn02_00217351 predicted 1038
5 SASI_Rn02_00217352 predicted 794
6 SASI_Rn02_00217353 predicted 1039
7 SASI_Rn02_00217354 predicted 802
8 SASI_Rn02_00217355 predicted 1287
9 SASI_Rn02_00217356 predicted 1218
10 SASI_Rn02_00217357 predicted 782
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008589 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170416 predicted 1010
2 SASI_Mm01_00170418 predicted 872
3 SASI_Mm01_00170420 predicted 731
4 SASI_Mm01_00170421 predicted 1345
5 SASI_Mm01_00170425 predicted 1332
6 SASI_Mm01_00170422 predicted 1103
7 SASI_Mm01_00170424 predicted 463
8 SASI_Mm02_00314224 predicted 1001
9 SASI_Mm02_00314225 predicted 875
10 SASI_Mm02_00314226 predicted 873
11 SASI_Mm01_00170417 predicted 1368
12 SASI_Mm01_00170419 predicted 940
13 SASI_Mm01_00170423 predicted 1094
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008589
MESP2 MISSION shRNA Bacterial Glycerol Stock
mesoderm posterior 2 homolog (mouse)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008589.2-1004s21c1
Sequence:CCGGGAACCTGCAGAGCTGACTAAACTCGAGTTTAGTCAGCTCTGCAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008589.2-843s21c1
Sequence:CCGGCCTGGGTGACACCTCCTTATTCTCGAGAATAAGGAGGTGTCACCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008589.2-883s21c1
Sequence:CCGGCTTACACCAGTCCCTAGAAAGCTCGAGCTTTCTAGGGACTGGTGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008589.2-1753s21c1
Sequence:CCGGTACAGGTTGAGAACTACTATTCTCGAGAATAGTAGTTCTCAACCTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008589.2-738s21c1
Sequence:CCGGTGGGATCAGCCATGAGTAGTGCTCGAGCACTACTCATGGCTGATCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008589.1-1762s1c1
Sequence:CCGGGCTGAGAACTACTATTCTAAACTCGAGTTTAGAATAGTAGTTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008589.1-312s1c1
Sequence:CCGGCGTCCTCAGATTCGTCCGGTTCTCGAGAACCGGACGAATCTGAGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008589.1-797s1c1
Sequence:CCGGGACCTCTGATCTCACCTGAAACTCGAGTTTCAGGTGAGATCAGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008589.1-991s1c1
Sequence:CCGGCACTGGACACAATCCACTGAACTCGAGTTCAGTGGATTGTGTCCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008589.1-1015s1c1
Sequence:CCGGGCAGAGCTGACTAAAGTGTATCTCGAGATACACTTTAGTCAGCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008589
MESP2 MISSION shRNA shRNA Plasmid DNA
mesoderm posterior 2 homolog (mouse)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008589.2-1004s21c1
Sequence:CCGGGAACCTGCAGAGCTGACTAAACTCGAGTTTAGTCAGCTCTGCAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008589.2-843s21c1
Sequence:CCGGCCTGGGTGACACCTCCTTATTCTCGAGAATAAGGAGGTGTCACCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008589.2-883s21c1
Sequence:CCGGCTTACACCAGTCCCTAGAAAGCTCGAGCTTTCTAGGGACTGGTGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008589.2-1753s21c1
Sequence:CCGGTACAGGTTGAGAACTACTATTCTCGAGAATAGTAGTTCTCAACCTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008589.2-738s21c1
Sequence:CCGGTGGGATCAGCCATGAGTAGTGCTCGAGCACTACTCATGGCTGATCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008589.1-1762s1c1
Sequence:CCGGGCTGAGAACTACTATTCTAAACTCGAGTTTAGAATAGTAGTTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008589.1-312s1c1
Sequence:CCGGCGTCCTCAGATTCGTCCGGTTCTCGAGAACCGGACGAATCTGAGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008589.1-797s1c1
Sequence:CCGGGACCTCTGATCTCACCTGAAACTCGAGTTTCAGGTGAGATCAGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008589.1-991s1c1
Sequence:CCGGCACTGGACACAATCCACTGAACTCGAGTTCAGTGGATTGTGTCCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008589.1-1015s1c1
Sequence:CCGGGCAGAGCTGACTAAAGTGTATCTCGAGATACACTTTAGTCAGCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008589
MESP2 MISSION shRNA Lentiviral Transduction Particles
mesoderm posterior 2 homolog (mouse)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008589.2-1004s21c1
Sequence:CCGGGAACCTGCAGAGCTGACTAAACTCGAGTTTAGTCAGCTCTGCAGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008589.2-843s21c1
Sequence:CCGGCCTGGGTGACACCTCCTTATTCTCGAGAATAAGGAGGTGTCACCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008589.2-883s21c1
Sequence:CCGGCTTACACCAGTCCCTAGAAAGCTCGAGCTTTCTAGGGACTGGTGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008589.2-1753s21c1
Sequence:CCGGTACAGGTTGAGAACTACTATTCTCGAGAATAGTAGTTCTCAACCTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008589.2-738s21c1
Sequence:CCGGTGGGATCAGCCATGAGTAGTGCTCGAGCACTACTCATGGCTGATCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008589.1-1762s1c1
Sequence:CCGGGCTGAGAACTACTATTCTAAACTCGAGTTTAGAATAGTAGTTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008589.1-312s1c1
Sequence:CCGGCGTCCTCAGATTCGTCCGGTTCTCGAGAACCGGACGAATCTGAGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008589.1-797s1c1
Sequence:CCGGGACCTCTGATCTCACCTGAAACTCGAGTTTCAGGTGAGATCAGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008589.1-991s1c1
Sequence:CCGGCACTGGACACAATCCACTGAACTCGAGTTCAGTGGATTGTGTCCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008589.1-1015s1c1
Sequence:CCGGGCAGAGCTGACTAAAGTGTATCTCGAGATACACTTTAGTCAGCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_085261
MESP2 MISSION shRNA Bacterial Glycerol Stock
mesoderm posterior 2 homolog (mouse)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085261.2-895s1c1
Sequence:CCGGGCCGCCTTCCAGCTCAGTGAACTCGAGTTCACTGAGCTGGAAGGCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085261.2-104s1c1
Sequence:CCGGCCTCCTCCGATTCGTCGGGTTCTCGAGAACCCGACGAATCGGAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085261.2-990s1c1
Sequence:CCGGCCGCCTGGGCATCTTCTACTACTCGAGTAGTAGAAGATGCCCAGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085261.2-386s1c1
Sequence:CCGGTCCGCTACATCGGCCACCTATCTCGAGATAGGTGGCCGATGTAGCGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085261.2-955s1c1
Sequence:CCGGTGCCCTGAACTTTGGCAAGAACTCGAGTTCTTGCCAAAGTTCAGGGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_085261
MESP2 MISSION shRNA shRNA Plasmid DNA
mesoderm posterior 2 homolog (mouse)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085261.2-895s1c1
Sequence:CCGGGCCGCCTTCCAGCTCAGTGAACTCGAGTTCACTGAGCTGGAAGGCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085261.2-104s1c1
Sequence:CCGGCCTCCTCCGATTCGTCGGGTTCTCGAGAACCCGACGAATCGGAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085261.2-990s1c1
Sequence:CCGGCCGCCTGGGCATCTTCTACTACTCGAGTAGTAGAAGATGCCCAGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085261.2-386s1c1
Sequence:CCGGTCCGCTACATCGGCCACCTATCTCGAGATAGGTGGCCGATGTAGCGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085261.2-955s1c1
Sequence:CCGGTGCCCTGAACTTTGGCAAGAACTCGAGTTCTTGCCAAAGTTCAGGGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_085261
MESP2 MISSION shRNA Lentiviral Transduction Particles
mesoderm posterior 2 homolog (mouse)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085261.2-895s1c1
Sequence:CCGGGCCGCCTTCCAGCTCAGTGAACTCGAGTTCACTGAGCTGGAAGGCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085261.2-104s1c1
Sequence:CCGGCCTCCTCCGATTCGTCGGGTTCTCGAGAACCCGACGAATCGGAGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085261.2-990s1c1
Sequence:CCGGCCGCCTGGGCATCTTCTACTACTCGAGTAGTAGAAGATGCCCAGGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085261.2-386s1c1
Sequence:CCGGTCCGCTACATCGGCCACCTATCTCGAGATAGGTGGCCGATGTAGCGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085261.2-955s1c1
Sequence:CCGGTGCCCTGAACTTTGGCAAGAACTCGAGTTCTTGCCAAAGTTCAGGGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)