EMAIL THIS PAGE TO A FRIEND

MEST

mesoderm specific transcript

132 Gene Product Result for
Synonyms: PEG1
UniProtKB ID: Q5EB52, B2R6S1, O14973, O15007, Q6AI49, Q92571
Gene ID:
Human(4232) Summary: This gene encodes a member of the alpha/beta hydrolase superfamily. It is imprinted, exhibiting preferential expression from the paternal allele in fetal tissues, and isoform-specific imprinting in lymphocytes. The loss of imprinting of this gene has been linked to certain types of cancer and may be due to promotor switching. The encoded protein may play a role in development. Alternatively spliced transcript variants encoding multiple isoforms have been identified for this gene. Pseudogenes of this gene are located on the short arm of chromosomes 3 and 4, and the long arm of chromosomes 6 and 15. [provided by RefSeq, Dec 2011]
Mouse(17294) mesoderm specific transcript
Rat(58827) mesoderm specific transcript
Zebrafish(30242) mesoderm specific transcript
domestic cat(101091182) mesoderm specific transcript homolog (mouse)
cow(404180) mesoderm specific transcript homolog (mouse)
Horse(100057213) mesoderm specific transcript homolog (mouse)
dog(607717) mesoderm specific transcript homolog (mouse)
chicken(427684) mesoderm specific transcript homolog (mouse)
naked mole-rat(101697401) mesoderm specific transcript
Domestic Rabbit(100349576) mesoderm specific transcript homolog (mouse)
domestic guinea pig(100712943) mesoderm specific transcript
sheep(101118099) mesoderm specific transcript homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002402 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002402 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002402 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008590 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008590 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008590 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002402 Rosetta Predictions human pricing
NM_177524 Rosetta Predictions human pricing
NM_177525 Rosetta Predictions human pricing
NM_001009617 Rosetta Predictions rat pricing
NM_008590 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333774 predicted 1126
2 SASI_Hs01_00173296 predicted 934
3 SASI_Hs01_00173297 predicted 702
4 SASI_Hs01_00173298 predicted 628
5 SASI_Hs01_00173299 predicted 1223
6 SASI_Hs01_00173300 predicted 1319
7 SASI_Hs01_00173301 predicted 559
8 SASI_Hs01_00173302 predicted 685
9 SASI_Hs02_00333775 predicted 1214
10 SASI_Hs01_00173305 predicted 884
11 SASI_Hs01_00173303 predicted 1195
12 SASI_Hs01_00173304 predicted 1288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177524 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369358 predicted 1082
2 SASI_Hs01_00044039 predicted 879
3 SASI_Hs01_00044040 predicted 643
4 SASI_Hs01_00044041 predicted 579
5 SASI_Hs01_00044042 predicted 1169
6 SASI_Hs01_00044043 predicted 1267
7 SASI_Hs01_00044044 predicted 502
8 SASI_Hs01_00044045 predicted 627
9 SASI_Hs02_00369359 predicted 1166
10 SASI_Hs01_00044048 predicted 827
11 SASI_Hs01_00044046 predicted 1140
12 SASI_Hs01_00044047 predicted 1232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369360 predicted 1044
2 SASI_Hs01_00208800 predicted 840
3 SASI_Hs01_00208801 predicted 606
4 SASI_Hs01_00208802 predicted 545
5 SASI_Hs01_00208803 predicted 1133
6 SASI_Hs01_00208804 predicted 1229
7 SASI_Hs01_00208805 predicted 467
8 SASI_Hs01_00208806 predicted 592
9 SASI_Hs02_00369361 predicted 1128
10 SASI_Hs01_00208809 predicted 790
11 SASI_Hs01_00208807 predicted 1104
12 SASI_Hs01_00208808 predicted 1201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009617 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046366 predicted 744
2 SASI_Rn01_00046367 predicted 1111
3 SASI_Rn01_00046368 predicted 578
4 SASI_Rn01_00046369 predicted 1020
5 SASI_Rn01_00046370 predicted 555
6 SASI_Rn01_00046371 predicted 597
7 SASI_Rn01_00046372 predicted 911
8 SASI_Rn01_00046373 predicted 847
9 SASI_Rn01_00046375 predicted 536
10 SASI_Rn02_00199618 predicted 832
11 SASI_Rn01_00046374 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008590 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150305 predicted 856
2 SASI_Mm01_00150307 predicted 1294
3 SASI_Mm01_00150308 predicted 535
4 SASI_Mm01_00150310 predicted 663
5 SASI_Mm01_00150311 predicted 570
6 SASI_Mm01_00150312 predicted 1258
7 SASI_Mm01_00150313 predicted 395
8 SASI_Mm02_00314227 predicted 412
9 SASI_Mm01_00150314 predicted 1350
10 SASI_Mm02_00314228 predicted 953
11 SASI_Mm01_00150306 predicted 1098
12 SASI_Mm01_00150309 predicted 1021
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002402
VALIDATED
MEST MISSION shRNA Bacterial Glycerol Stock
mesoderm specific transcript
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002402.2-1392s1c1
Sequence:CCGGGCTCTGACTAAGGTTGACATACTCGAGTATGTCAACCTTAGTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002402.2-935s1c1
Sequence:CCGGCGCAACAATGACGGGAACTTACTCGAGTAAGTTCCCGTCATTGTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002402.2-496s1c1
Sequence:CCGGCTTGAGGTTTCATCGGGTGATCTCGAGATCACCCGATGAAACCTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002402.2-632s1c1
Sequence:CCGGCGCAGGATCAACCTTCTTTCTCTCGAGAGAAAGAAGGTTGATCCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002402.2-833s1c1
Sequence:CCGGCGACTGATGAACTTCTTTGTACTCGAGTACAAAGAAGTTCATCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002402.2-1392s21c1
Sequence:CCGGGCTCTGACTAAGGTTGACATACTCGAGTATGTCAACCTTAGTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002402.2-496s21c1
Sequence:CCGGCTTGAGGTTTCATCGGGTGATCTCGAGATCACCCGATGAAACCTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002402.2-833s21c1
Sequence:CCGGCGACTGATGAACTTCTTTGTACTCGAGTACAAAGAAGTTCATCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002402.2-632s21c1
Sequence:CCGGCGCAGGATCAACCTTCTTTCTCTCGAGAGAAAGAAGGTTGATCCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002402
VALIDATED
MEST MISSION shRNA shRNA Plasmid DNA
mesoderm specific transcript
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002402.2-1392s1c1
Sequence:CCGGGCTCTGACTAAGGTTGACATACTCGAGTATGTCAACCTTAGTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002402.2-935s1c1
Sequence:CCGGCGCAACAATGACGGGAACTTACTCGAGTAAGTTCCCGTCATTGTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002402.2-496s1c1
Sequence:CCGGCTTGAGGTTTCATCGGGTGATCTCGAGATCACCCGATGAAACCTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002402.2-632s1c1
Sequence:CCGGCGCAGGATCAACCTTCTTTCTCTCGAGAGAAAGAAGGTTGATCCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002402.2-833s1c1
Sequence:CCGGCGACTGATGAACTTCTTTGTACTCGAGTACAAAGAAGTTCATCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002402.2-1392s21c1
Sequence:CCGGGCTCTGACTAAGGTTGACATACTCGAGTATGTCAACCTTAGTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002402.2-496s21c1
Sequence:CCGGCTTGAGGTTTCATCGGGTGATCTCGAGATCACCCGATGAAACCTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002402.2-833s21c1
Sequence:CCGGCGACTGATGAACTTCTTTGTACTCGAGTACAAAGAAGTTCATCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002402.2-632s21c1
Sequence:CCGGCGCAGGATCAACCTTCTTTCTCTCGAGAGAAAGAAGGTTGATCCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002402
VALIDATED
MEST MISSION shRNA Lentiviral Transduction Particles
mesoderm specific transcript
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002402.2-1392s1c1
Sequence:CCGGGCTCTGACTAAGGTTGACATACTCGAGTATGTCAACCTTAGTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002402.2-935s1c1
Sequence:CCGGCGCAACAATGACGGGAACTTACTCGAGTAAGTTCCCGTCATTGTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002402.2-496s1c1
Sequence:CCGGCTTGAGGTTTCATCGGGTGATCTCGAGATCACCCGATGAAACCTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002402.2-632s1c1
Sequence:CCGGCGCAGGATCAACCTTCTTTCTCTCGAGAGAAAGAAGGTTGATCCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002402.2-833s1c1
Sequence:CCGGCGACTGATGAACTTCTTTGTACTCGAGTACAAAGAAGTTCATCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002402.2-1392s21c1
Sequence:CCGGGCTCTGACTAAGGTTGACATACTCGAGTATGTCAACCTTAGTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002402.2-496s21c1
Sequence:CCGGCTTGAGGTTTCATCGGGTGATCTCGAGATCACCCGATGAAACCTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002402.2-833s21c1
Sequence:CCGGCGACTGATGAACTTCTTTGTACTCGAGTACAAAGAAGTTCATCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002402.2-632s21c1
Sequence:CCGGCGCAGGATCAACCTTCTTTCTCTCGAGAGAAAGAAGGTTGATCCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008590
VALIDATED
MEST MISSION shRNA Bacterial Glycerol Stock
mesoderm specific transcript
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000032675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008590.1-548s1c1
Sequence:CCGGGCCCTTGATTTCTTAGGCTTTCTCGAGAAAGCCTAAGAAATCAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008590.1-590s1c1
Sequence:CCGGCCACATCAGTACTCCATATTTCTCGAGAAATATGGAGTACTGATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008590.1-1222s1c1
Sequence:CCGGGAATGCATATATGGGCTTCATCTCGAGATGAAGCCCATATATGCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008590.1-900s1c1
Sequence:CCGGCTCCAGTCTTTGGACCGTATACTCGAGTATACGGTCCAAAGACTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008590
VALIDATED
MEST MISSION shRNA shRNA Plasmid DNA
mesoderm specific transcript
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000032675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008590.1-548s1c1
Sequence:CCGGGCCCTTGATTTCTTAGGCTTTCTCGAGAAAGCCTAAGAAATCAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008590.1-590s1c1
Sequence:CCGGCCACATCAGTACTCCATATTTCTCGAGAAATATGGAGTACTGATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008590.1-1222s1c1
Sequence:CCGGGAATGCATATATGGGCTTCATCTCGAGATGAAGCCCATATATGCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008590.1-900s1c1
Sequence:CCGGCTCCAGTCTTTGGACCGTATACTCGAGTATACGGTCCAAAGACTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008590
VALIDATED
MEST MISSION shRNA Lentiviral Transduction Particles
mesoderm specific transcript
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000032675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008590.1-548s1c1
Sequence:CCGGGCCCTTGATTTCTTAGGCTTTCTCGAGAAAGCCTAAGAAATCAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008590.1-590s1c1
Sequence:CCGGCCACATCAGTACTCCATATTTCTCGAGAAATATGGAGTACTGATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008590.1-1222s1c1
Sequence:CCGGGAATGCATATATGGGCTTCATCTCGAGATGAAGCCCATATATGCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008590.1-900s1c1
Sequence:CCGGCTCCAGTCTTTGGACCGTATACTCGAGTATACGGTCCAAAGACTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)