EMAIL THIS PAGE TO A FRIEND

METAP1

methionyl aminopeptidase 1

202 Gene Product Result for
Synonyms: MAP1A MetAP1A
UniProtKB ID: P53582, B4E2E6
Gene ID:
Mouse(75624) methionyl aminopeptidase 1
Rat(295500) methionyl aminopeptidase 1
sheep(101123124) methionyl aminopeptidase 1
domestic guinea pig(100719144) methionyl aminopeptidase 1
Zebrafish(503783) methionyl aminopeptidase 1
dog(487871) methionyl aminopeptidase 1
domestic cat(101088407) methionyl aminopeptidase 1
cow(516540) methionyl aminopeptidase 1
chicken(422704) methionyl aminopeptidase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015143 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015143 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015143 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175224 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175224 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175224 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015143 Rosetta Predictions human pricing
NM_001106476 Rosetta Predictions rat pricing
NM_175224 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015143 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347075 predicted 711
2 SASI_Hs02_00347076 predicted 480
3 SASI_Hs02_00347077 predicted 258
4 SASI_Hs01_00181554 predicted 985
5 SASI_Hs02_00347078 predicted 354
6 SASI_Hs02_00347079 predicted 616
7 SASI_Hs02_00347080 predicted 564
8 SASI_Hs02_00347081 predicted 771
9 SASI_Hs02_00347082 predicted 395
10 SASI_Hs01_00181558 predicted 640
11 SASI_Hs01_00181552 predicted 410
12 SASI_Hs01_00181553 predicted 1020
13 SASI_Hs01_00181555 predicted 556
14 SASI_Hs01_00181556 predicted 903
15 SASI_Hs01_00181557 predicted 306
16 SASI_Hs01_00181559 predicted 867
17 SASI_Hs01_00181560 predicted 853
18 SASI_Hs01_00181561 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106476 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219338 predicted 534
2 SASI_Rn02_00219339 predicted 443
3 SASI_Rn02_00219340 predicted 330
4 SASI_Rn02_00219341 predicted 454
5 SASI_Rn02_00219342 predicted 670
6 SASI_Rn02_00219343 predicted 932
7 SASI_Rn02_00219344 predicted 402
8 SASI_Rn02_00219345 predicted 429
9 SASI_Rn02_00219346 predicted 595
10 SASI_Rn02_00219347 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175224 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165448 predicted 395
2 SASI_Mm02_00345901 predicted 455
3 SASI_Mm01_00165450 predicted 601
4 SASI_Mm01_00165451 predicted 520
5 SASI_Mm01_00165452 predicted 864
6 SASI_Mm01_00165453 predicted 830
7 SASI_Mm01_00165454 predicted 260
8 SASI_Mm01_00165455 predicted 672
9 SASI_Mm02_00345902 predicted 400
10 SASI_Mm01_00165456 predicted 833
11 SASI_Mm01_00165449 predicted 467
12 SASI_Mm01_00165457 predicted 542
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015143
VALIDATED
METAP1 MISSION shRNA Bacterial Glycerol Stock
methionyl aminopeptidase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015143.1-139s1c1
Sequence:CCGGGCATGATTAAACCAGGTGTAACTCGAGTTACACCTGGTTTAATCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015143.1-658s1c1
Sequence:CCGGCAATGATTTGTGAAGGCGGATCTCGAGATCCGCCTTCACAAATCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015143.1-813s1c1
Sequence:CCGGCCTCACTTCATGTCTCAATTTCTCGAGAAATTGAGACATGAAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015143.1-303s1c1
Sequence:CCGGCCCTTACAAGAAGGTGACATTCTCGAGAATGTCACCTTCTTGTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015143.1-179s1c1
Sequence:CCGGCGCTGTACACTTAGCATGTATCTCGAGATACATGCTAAGTGTACAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015143.2-404s21c1
Sequence:CCGGCAAGGCCAGTGCCAAGTTATACTCGAGTATAACTTGGCACTGGCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015143.2-1088s21c1
Sequence:CCGGTTACAATTGAGCCAATGATTTCTCGAGAAATCATTGGCTCAATTGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015143.2-1755s21c1
Sequence:CCGGTCTGCTCTGACAGGTTTATATCTCGAGATATAAACCTGTCAGAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015143.2-347s21c1
Sequence:CCGGCATGGGCAGGTTATCGATATACTCGAGTATATCGATAACCTGCCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015143.2-569s21c1
Sequence:CCGGATGTTGCTGCCGGCATGATTACTCGAGTAATCATGCCGGCAGCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015143
VALIDATED
METAP1 MISSION shRNA shRNA Plasmid DNA
methionyl aminopeptidase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015143.1-139s1c1
Sequence:CCGGGCATGATTAAACCAGGTGTAACTCGAGTTACACCTGGTTTAATCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015143.1-658s1c1
Sequence:CCGGCAATGATTTGTGAAGGCGGATCTCGAGATCCGCCTTCACAAATCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015143.1-813s1c1
Sequence:CCGGCCTCACTTCATGTCTCAATTTCTCGAGAAATTGAGACATGAAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015143.1-303s1c1
Sequence:CCGGCCCTTACAAGAAGGTGACATTCTCGAGAATGTCACCTTCTTGTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015143.1-179s1c1
Sequence:CCGGCGCTGTACACTTAGCATGTATCTCGAGATACATGCTAAGTGTACAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015143.2-404s21c1
Sequence:CCGGCAAGGCCAGTGCCAAGTTATACTCGAGTATAACTTGGCACTGGCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015143.2-1088s21c1
Sequence:CCGGTTACAATTGAGCCAATGATTTCTCGAGAAATCATTGGCTCAATTGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015143.2-1755s21c1
Sequence:CCGGTCTGCTCTGACAGGTTTATATCTCGAGATATAAACCTGTCAGAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015143.2-347s21c1
Sequence:CCGGCATGGGCAGGTTATCGATATACTCGAGTATATCGATAACCTGCCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015143.2-569s21c1
Sequence:CCGGATGTTGCTGCCGGCATGATTACTCGAGTAATCATGCCGGCAGCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015143
VALIDATED
METAP1 MISSION shRNA Lentiviral Transduction Particles
methionyl aminopeptidase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015143.1-139s1c1
Sequence:CCGGGCATGATTAAACCAGGTGTAACTCGAGTTACACCTGGTTTAATCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015143.1-658s1c1
Sequence:CCGGCAATGATTTGTGAAGGCGGATCTCGAGATCCGCCTTCACAAATCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015143.1-813s1c1
Sequence:CCGGCCTCACTTCATGTCTCAATTTCTCGAGAAATTGAGACATGAAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015143.1-303s1c1
Sequence:CCGGCCCTTACAAGAAGGTGACATTCTCGAGAATGTCACCTTCTTGTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015143.1-179s1c1
Sequence:CCGGCGCTGTACACTTAGCATGTATCTCGAGATACATGCTAAGTGTACAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015143.2-404s21c1
Sequence:CCGGCAAGGCCAGTGCCAAGTTATACTCGAGTATAACTTGGCACTGGCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015143.2-1088s21c1
Sequence:CCGGTTACAATTGAGCCAATGATTTCTCGAGAAATCATTGGCTCAATTGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015143.2-1755s21c1
Sequence:CCGGTCTGCTCTGACAGGTTTATATCTCGAGATATAAACCTGTCAGAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015143.2-347s21c1
Sequence:CCGGCATGGGCAGGTTATCGATATACTCGAGTATATCGATAACCTGCCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015143.2-569s21c1
Sequence:CCGGATGTTGCTGCCGGCATGATTACTCGAGTAATCATGCCGGCAGCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175224
VALIDATED
METAP1 MISSION shRNA Bacterial Glycerol Stock
methionyl aminopeptidase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175224.2-640s1c1
Sequence:CCGGCCTTTGCAAGAAGGTGATATTCTCGAGAATATCACCTTCTTGCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175224.2-746s1c1
Sequence:CCGGCACGGAAACTTGTTCAGACTACTCGAGTAGTCTGAACAAGTTTCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175224.2-148s1c1
Sequence:CCGGGCCACTCACAAGTTACTACATCTCGAGATGTAGTAACTTGTGAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175224.2-1150s1c1
Sequence:CCGGCCTCATTTCATGTCCCAGTTTCTCGAGAAACTGGGACATGAAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175224.4-1149s21c1
Sequence:CCGGCCTCATTTCATGTCCCAGTTTCTCGAGAAACTGGGACATGAAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175224.4-745s21c1
Sequence:CCGGCACGGAAACTTGTTCAGACTACTCGAGTAGTCTGAACAAGTTTCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175224.4-639s21c1
Sequence:CCGGCCTTTGCAAGAAGGTGATATTCTCGAGAATATCACCTTCTTGCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175224.4-147s21c1
Sequence:CCGGGCCACTCACAAGTTACTACATCTCGAGATGTAGTAACTTGTGAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175224
VALIDATED
METAP1 MISSION shRNA shRNA Plasmid DNA
methionyl aminopeptidase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175224.2-640s1c1
Sequence:CCGGCCTTTGCAAGAAGGTGATATTCTCGAGAATATCACCTTCTTGCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175224.2-746s1c1
Sequence:CCGGCACGGAAACTTGTTCAGACTACTCGAGTAGTCTGAACAAGTTTCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175224.2-148s1c1
Sequence:CCGGGCCACTCACAAGTTACTACATCTCGAGATGTAGTAACTTGTGAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175224.2-1150s1c1
Sequence:CCGGCCTCATTTCATGTCCCAGTTTCTCGAGAAACTGGGACATGAAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175224.4-1149s21c1
Sequence:CCGGCCTCATTTCATGTCCCAGTTTCTCGAGAAACTGGGACATGAAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175224.4-745s21c1
Sequence:CCGGCACGGAAACTTGTTCAGACTACTCGAGTAGTCTGAACAAGTTTCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175224.4-639s21c1
Sequence:CCGGCCTTTGCAAGAAGGTGATATTCTCGAGAATATCACCTTCTTGCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175224.4-147s21c1
Sequence:CCGGGCCACTCACAAGTTACTACATCTCGAGATGTAGTAACTTGTGAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175224
VALIDATED
METAP1 MISSION shRNA Lentiviral Transduction Particles
methionyl aminopeptidase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175224.2-640s1c1
Sequence:CCGGCCTTTGCAAGAAGGTGATATTCTCGAGAATATCACCTTCTTGCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175224.2-746s1c1
Sequence:CCGGCACGGAAACTTGTTCAGACTACTCGAGTAGTCTGAACAAGTTTCCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175224.2-148s1c1
Sequence:CCGGGCCACTCACAAGTTACTACATCTCGAGATGTAGTAACTTGTGAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175224.2-1150s1c1
Sequence:CCGGCCTCATTTCATGTCCCAGTTTCTCGAGAAACTGGGACATGAAATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175224.4-1149s21c1
Sequence:CCGGCCTCATTTCATGTCCCAGTTTCTCGAGAAACTGGGACATGAAATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175224.4-745s21c1
Sequence:CCGGCACGGAAACTTGTTCAGACTACTCGAGTAGTCTGAACAAGTTTCCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175224.4-639s21c1
Sequence:CCGGCCTTTGCAAGAAGGTGATATTCTCGAGAATATCACCTTCTTGCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175224.4-147s21c1
Sequence:CCGGGCCACTCACAAGTTACTACATCTCGAGATGTAGTAACTTGTGAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)