EMAIL THIS PAGE TO A FRIEND

METAP1D

methionyl aminopeptidase type 1D (mitochondrial)

51 Gene Product Result for
Synonyms: MAP 1D MAP1D MetAP 1D Metap1l
UniProtKB ID: Q6UB28, Q1WNX3
Gene ID:
Human(254042) Summary: The N-terminal methionine excision pathway is an essential process in which the N-terminal methionine is removed from many proteins, thus facilitating subsequent protein modification. In mitochondria, enzymes that catalyze this reaction are celled methionine aminopeptidases (MetAps, or MAPs; EC 3.4.11.18) (Serero et al., 2003 [PubMed 14532271]
Mouse(66559) methionyl aminopeptidase type 1D (mitochondrial)
Rat(311748) methionyl aminopeptidase type 1D (mitochondrial)
Zebrafish(554090) methionyl aminopeptidase type 1D (mitochondrial)
domestic cat(101091549) methionyl aminopeptidase type 1D (mitochondrial)
dog(488399) methionyl aminopeptidase type 1D (mitochondrial)
cow(533042) methionyl aminopeptidase type 1D (mitochondrial)
chicken(424150) methionyl aminopeptidase type 1D (mitochondrial)
domestic guinea pig(100731790) methionyl aminopeptidase type 1D (mitochondrial)
naked mole-rat(101703303) methionyl aminopeptidase type 1D (mitochondrial)
sheep(101114168) methionyl aminopeptidase type 1D (mitochondrial)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199227 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199227 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199227 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025633 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025633 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025633 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199227 Rosetta Predictions human pricing
NM_001107812 Rosetta Predictions rat pricing
NM_025633 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139473 predicted 280
2 SASI_Hs02_00372673 predicted 745
3 SASI_Hs01_00139474 predicted 765
4 SASI_Hs01_00139475 predicted 604
5 SASI_Hs01_00139476 predicted 459
6 SASI_Hs01_00139479 predicted 704
7 SASI_Hs02_00372674 predicted 608
8 SASI_Hs01_00139480 predicted 516
9 SASI_Hs01_00139481 predicted 441
10 SASI_Hs01_00139482 predicted 773
11 SASI_Hs01_00139477 predicted 326
12 SASI_Hs01_00139478 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107812 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232515 predicted 577
2 SASI_Rn02_00232516 predicted 621
3 SASI_Rn02_00232517 predicted 271
4 SASI_Rn02_00232518 predicted 486
5 SASI_Rn02_00232519 predicted 913
6 SASI_Rn02_00232520 predicted 447
7 SASI_Rn02_00232521 predicted 676
8 SASI_Rn02_00232522 predicted 896
9 SASI_Rn02_00232523 predicted 635
10 SASI_Rn02_00232524 predicted 600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025633 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088216 predicted 529
2 SASI_Mm01_00088217 predicted 270
3 SASI_Mm01_00088218 predicted 285
4 SASI_Mm01_00088219 predicted 463
5 SASI_Mm01_00088220 predicted 606
6 SASI_Mm01_00088221 predicted 551
7 SASI_Mm01_00088222 predicted 652
8 SASI_Mm01_00088223 predicted 711
9 SASI_Mm01_00088225 predicted 866
10 SASI_Mm02_00328693 predicted 721
11 SASI_Mm01_00088224 predicted 559
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199227
METAP1D MISSION shRNA Bacterial Glycerol Stock
methionyl aminopeptidase type 1D (mitochondrial)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199227.1-585s21c1
Sequence:CCGGATGGAGATATTATCAACATTGCTCGAGCAATGTTGATAATATCTCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199227.1-106s1c1
Sequence:CCGGCCGCAGAGGTTCTCATAGAATCTCGAGATTCTATGAGAACCTCTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199227.1-461s1c1
Sequence:CCGGCGGGAAATCATCAGTCATAATCTCGAGATTATGACTGATGATTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199227.1-137s1c1
Sequence:CCGGCCACTCAATCATATCTACTTACTCGAGTAAGTAGATATGATTGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199227.1-869s1c1
Sequence:CCGGCATCATGCAAACGACAGTGATCTCGAGATCACTGTCGTTTGCATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199227.1-754s1c1
Sequence:CCGGCTCTGTAATTGGAAACACAATCTCGAGATTGTGTTTCCAATTACAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199227.1-824s21c1
Sequence:CCGGGGACATGGAATAGGATCTTACCTCGAGGTAAGATCCTATTCCATGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199227
METAP1D MISSION shRNA shRNA Plasmid DNA
methionyl aminopeptidase type 1D (mitochondrial)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199227.1-585s21c1
Sequence:CCGGATGGAGATATTATCAACATTGCTCGAGCAATGTTGATAATATCTCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199227.1-106s1c1
Sequence:CCGGCCGCAGAGGTTCTCATAGAATCTCGAGATTCTATGAGAACCTCTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199227.1-461s1c1
Sequence:CCGGCGGGAAATCATCAGTCATAATCTCGAGATTATGACTGATGATTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199227.1-137s1c1
Sequence:CCGGCCACTCAATCATATCTACTTACTCGAGTAAGTAGATATGATTGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199227.1-869s1c1
Sequence:CCGGCATCATGCAAACGACAGTGATCTCGAGATCACTGTCGTTTGCATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199227.1-754s1c1
Sequence:CCGGCTCTGTAATTGGAAACACAATCTCGAGATTGTGTTTCCAATTACAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199227.1-824s21c1
Sequence:CCGGGGACATGGAATAGGATCTTACCTCGAGGTAAGATCCTATTCCATGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199227
METAP1D MISSION shRNA Lentiviral Transduction Particles
methionyl aminopeptidase type 1D (mitochondrial)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199227.1-585s21c1
Sequence:CCGGATGGAGATATTATCAACATTGCTCGAGCAATGTTGATAATATCTCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199227.1-106s1c1
Sequence:CCGGCCGCAGAGGTTCTCATAGAATCTCGAGATTCTATGAGAACCTCTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199227.1-461s1c1
Sequence:CCGGCGGGAAATCATCAGTCATAATCTCGAGATTATGACTGATGATTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199227.1-137s1c1
Sequence:CCGGCCACTCAATCATATCTACTTACTCGAGTAAGTAGATATGATTGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199227.1-869s1c1
Sequence:CCGGCATCATGCAAACGACAGTGATCTCGAGATCACTGTCGTTTGCATGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199227.1-754s1c1
Sequence:CCGGCTCTGTAATTGGAAACACAATCTCGAGATTGTGTTTCCAATTACAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199227.1-824s21c1
Sequence:CCGGGGACATGGAATAGGATCTTACCTCGAGGTAAGATCCTATTCCATGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025633
METAP1D MISSION shRNA Bacterial Glycerol Stock
methionyl aminopeptidase type 1D (mitochondrial)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025633.1-219s1c1
Sequence:CCGGGCGCATAAAGAAGCCAGACTACTCGAGTAGTCTGGCTTCTTTATGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025633.1-723s1c1
Sequence:CCGGCAGCCGCATAACTCATCAGAACTCGAGTTCTGATGAGTTATGCGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025633.1-595s1c1
Sequence:CCGGGAAACCTTTCTGGTGGGCAATCTCGAGATTGCCCACCAGAAAGGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025633.1-84s1c1
Sequence:CCGGGCCACTCAATCATATCTACTTCTCGAGAAGTAGATATGATTGAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025633.1-119s1c1
Sequence:CCGGGCAGTCAACAAAGAAGACATTCTCGAGAATGTCTTCTTTGTTGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025633
METAP1D MISSION shRNA shRNA Plasmid DNA
methionyl aminopeptidase type 1D (mitochondrial)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025633.1-219s1c1
Sequence:CCGGGCGCATAAAGAAGCCAGACTACTCGAGTAGTCTGGCTTCTTTATGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025633.1-723s1c1
Sequence:CCGGCAGCCGCATAACTCATCAGAACTCGAGTTCTGATGAGTTATGCGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025633.1-595s1c1
Sequence:CCGGGAAACCTTTCTGGTGGGCAATCTCGAGATTGCCCACCAGAAAGGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025633.1-84s1c1
Sequence:CCGGGCCACTCAATCATATCTACTTCTCGAGAAGTAGATATGATTGAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025633.1-119s1c1
Sequence:CCGGGCAGTCAACAAAGAAGACATTCTCGAGAATGTCTTCTTTGTTGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025633
METAP1D MISSION shRNA Lentiviral Transduction Particles
methionyl aminopeptidase type 1D (mitochondrial)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025633.1-219s1c1
Sequence:CCGGGCGCATAAAGAAGCCAGACTACTCGAGTAGTCTGGCTTCTTTATGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025633.1-723s1c1
Sequence:CCGGCAGCCGCATAACTCATCAGAACTCGAGTTCTGATGAGTTATGCGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025633.1-595s1c1
Sequence:CCGGGAAACCTTTCTGGTGGGCAATCTCGAGATTGCCCACCAGAAAGGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025633.1-84s1c1
Sequence:CCGGGCCACTCAATCATATCTACTTCTCGAGAAGTAGATATGATTGAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025633.1-119s1c1
Sequence:CCGGGCAGTCAACAAAGAAGACATTCTCGAGAATGTCTTCTTTGTTGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)