EMAIL THIS PAGE TO A FRIEND

METAP2

methionyl aminopeptidase 2

267 Gene Product Result for
Synonyms: MAP2 MNPEP p67 p67eIF2
UniProtKB ID: P50579, B2RDI8
Gene ID:
Human(10988) Summary: This gene is a member of the methionyl aminopeptidase family and encodes a protein that binds 2 cobalt or manganese ions. This protein functions both by protecting the alpha subunit of eukaryotic initiation factor 2 from inhibitory phosphorylation and by removing the amino-terminal methionine residue from nascent protein. Increased expression of this gene is associated with various forms of cancer and the anti-cancer drugs fumagillin and ovalicin inhibit the protein by irreversibly binding to its active site. A pseudogene of this gene is located on chromosome 2. [provided by RefSeq, Jul 2008]
Mouse(56307) methionine aminopeptidase 2
Rat(64370) methionyl aminopeptidase 2
sheep(101117320) methionyl aminopeptidase 2
naked mole-rat(101705501) methionyl aminopeptidase 2
domestic guinea pig(100724502) methionyl aminopeptidase 2
chicken(417912) methionyl aminopeptidase 2
cow(404150) methionyl aminopeptidase 2
Horse(100052132) methionyl aminopeptidase 2
domestic cat(101082672) methionyl aminopeptidase 2
dog(475429) methionyl aminopeptidase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006838 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006838 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006838 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019648 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019648 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019648 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006838 Rosetta Predictions human pricing
NM_022539 Rosetta Predictions rat pricing
NM_019648 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114122 predicted 895
2 SASI_Hs01_00114123 predicted 1300
3 SASI_Hs01_00114126 predicted 1480
4 SASI_Hs01_00114127 predicted 1212
5 SASI_Hs01_00114128 predicted 1444
6 SASI_Hs02_00342406 predicted 1491
7 SASI_Hs02_00342407 predicted 1053
8 SASI_Hs02_00342408 predicted 890
9 SASI_Hs01_00114131 predicted 1417
10 SASI_Hs02_00342409 predicted 998
11 SASI_Hs01_00114124 predicted 961
12 SASI_Hs01_00114125 predicted 1308
13 SASI_Hs01_00114129 predicted 991
14 SASI_Hs01_00114130 predicted 1172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022539 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094029 predicted 1625
2 SASI_Rn01_00094030 predicted 1580
3 SASI_Rn01_00094034 predicted 853
4 SASI_Rn01_00094036 predicted 1615
5 SASI_Rn02_00263299 predicted 783
6 SASI_Rn02_00263300 predicted 1073
7 SASI_Rn02_00263301 predicted 890
8 SASI_Rn02_00263302 predicted 1420
9 SASI_Rn02_00263303 predicted 704
10 SASI_Rn02_00263304 predicted 1009
11 SASI_Rn01_00094031 predicted 1218
12 SASI_Rn01_00094032 predicted 1442
13 SASI_Rn01_00094033 predicted 1455
14 SASI_Rn01_00094035 predicted 1210
15 SASI_Rn01_00094037 predicted 1291
16 SASI_Rn01_00094038 predicted 1539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019648 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094804 predicted 1390
2 SASI_Mm01_00094805 predicted 1448
3 SASI_Mm01_00094806 predicted 2056
4 SASI_Mm01_00094807 predicted 1671
5 SASI_Mm01_00094808 predicted 1518
6 SASI_Mm01_00094809 predicted 1520
7 SASI_Mm01_00094810 predicted 2029
8 SASI_Mm01_00094811 predicted 1495
9 SASI_Mm02_00324690 predicted 2000
10 SASI_Mm01_00094812 predicted 1512
11 SASI_Mm01_00094803 predicted 1815
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006838
VALIDATED
METAP2 MISSION shRNA Bacterial Glycerol Stock
methionyl aminopeptidase 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006838.2-719s1c1
Sequence:CCGGGCTGCCCATTATACTCCCAATCTCGAGATTGGGAGTATAATGGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006838.2-1300s1c1
Sequence:CCGGCTTGGGAGAAAGTAAATACTTCTCGAGAAGTATTTACTTTCTCCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006838.2-551s1c1
Sequence:CCGGGCAGAAGCACATCGACAAGTTCTCGAGAACTTGTCGATGTGCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006838.2-317s1c1
Sequence:CCGGGCAACTGGAAAGAAGAAGAAACTCGAGTTTCTTCTTCTTTCCAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306917    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006838.3-1715s21c1
Sequence:CCGGGACAAAGGCAAACCGTCTAATCTCGAGATTAGACGGTTTGCCTTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006838.3-1488s21c1
Sequence:CCGGGGATCATATACAGCGCAATTTCTCGAGAAATTGCGCTGTATATGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006838.3-651s21c1
Sequence:CCGGGCAGAAGCACATCGACAAGTTCTCGAGAACTTGTCGATGTGCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006838.3-523s21c1
Sequence:CCGGCCAAAGGACAAGAATGCGAATCTCGAGATTCGCATTCTTGTCCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006838.3-945s21c1
Sequence:CCGGCCCAAATATGATACGTTATTACTCGAGTAATAACGTATCATATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006838
VALIDATED
METAP2 MISSION shRNA shRNA Plasmid DNA
methionyl aminopeptidase 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006838.2-719s1c1
Sequence:CCGGGCTGCCCATTATACTCCCAATCTCGAGATTGGGAGTATAATGGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006838.2-1300s1c1
Sequence:CCGGCTTGGGAGAAAGTAAATACTTCTCGAGAAGTATTTACTTTCTCCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006838.2-551s1c1
Sequence:CCGGGCAGAAGCACATCGACAAGTTCTCGAGAACTTGTCGATGTGCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006838.2-317s1c1
Sequence:CCGGGCAACTGGAAAGAAGAAGAAACTCGAGTTTCTTCTTCTTTCCAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306917    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006838.3-1715s21c1
Sequence:CCGGGACAAAGGCAAACCGTCTAATCTCGAGATTAGACGGTTTGCCTTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006838.3-1488s21c1
Sequence:CCGGGGATCATATACAGCGCAATTTCTCGAGAAATTGCGCTGTATATGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006838.3-651s21c1
Sequence:CCGGGCAGAAGCACATCGACAAGTTCTCGAGAACTTGTCGATGTGCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006838.3-523s21c1
Sequence:CCGGCCAAAGGACAAGAATGCGAATCTCGAGATTCGCATTCTTGTCCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006838.3-945s21c1
Sequence:CCGGCCCAAATATGATACGTTATTACTCGAGTAATAACGTATCATATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006838
VALIDATED
METAP2 MISSION shRNA Lentiviral Transduction Particles
methionyl aminopeptidase 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006838.2-719s1c1
Sequence:CCGGGCTGCCCATTATACTCCCAATCTCGAGATTGGGAGTATAATGGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006838.2-1300s1c1
Sequence:CCGGCTTGGGAGAAAGTAAATACTTCTCGAGAAGTATTTACTTTCTCCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006838.2-551s1c1
Sequence:CCGGGCAGAAGCACATCGACAAGTTCTCGAGAACTTGTCGATGTGCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006838.2-317s1c1
Sequence:CCGGGCAACTGGAAAGAAGAAGAAACTCGAGTTTCTTCTTCTTTCCAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306917    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006838.3-1715s21c1
Sequence:CCGGGACAAAGGCAAACCGTCTAATCTCGAGATTAGACGGTTTGCCTTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006838.3-1488s21c1
Sequence:CCGGGGATCATATACAGCGCAATTTCTCGAGAAATTGCGCTGTATATGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006838.3-651s21c1
Sequence:CCGGGCAGAAGCACATCGACAAGTTCTCGAGAACTTGTCGATGTGCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006838.3-523s21c1
Sequence:CCGGCCAAAGGACAAGAATGCGAATCTCGAGATTCGCATTCTTGTCCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006838.3-945s21c1
Sequence:CCGGCCCAAATATGATACGTTATTACTCGAGTAATAACGTATCATATTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019648
METAP2 MISSION shRNA Bacterial Glycerol Stock
methionyl aminopeptidase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019648.2-939s1c1
Sequence:CCGGGCTGTAAAGGATGCCACTAATCTCGAGATTAGTGGCATCCTTTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019648.2-470s1c1
Sequence:CCGGCCTGTATCCTAATGGTGTATTCTCGAGAATACACCATTAGGATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019648.2-1064s1c1
Sequence:CCGGCCAAGTGAAACCCATACGTAACTCGAGTTACGTATGGGTTTCACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019648.2-492s1c1
Sequence:CCGGCCCAAAGGACAAGAGTGTGAACTCGAGTTCACACTCTTGTCCTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019648.2-669s1c1
Sequence:CCGGCCTGGGATGACGATGATAGAACTCGAGTTCTATCATCGTCATCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019648
METAP2 MISSION shRNA shRNA Plasmid DNA
methionyl aminopeptidase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019648.2-939s1c1
Sequence:CCGGGCTGTAAAGGATGCCACTAATCTCGAGATTAGTGGCATCCTTTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019648.2-470s1c1
Sequence:CCGGCCTGTATCCTAATGGTGTATTCTCGAGAATACACCATTAGGATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019648.2-1064s1c1
Sequence:CCGGCCAAGTGAAACCCATACGTAACTCGAGTTACGTATGGGTTTCACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019648.2-492s1c1
Sequence:CCGGCCCAAAGGACAAGAGTGTGAACTCGAGTTCACACTCTTGTCCTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019648.2-669s1c1
Sequence:CCGGCCTGGGATGACGATGATAGAACTCGAGTTCTATCATCGTCATCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019648
METAP2 MISSION shRNA Lentiviral Transduction Particles
methionyl aminopeptidase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019648.2-939s1c1
Sequence:CCGGGCTGTAAAGGATGCCACTAATCTCGAGATTAGTGGCATCCTTTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019648.2-470s1c1
Sequence:CCGGCCTGTATCCTAATGGTGTATTCTCGAGAATACACCATTAGGATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019648.2-1064s1c1
Sequence:CCGGCCAAGTGAAACCCATACGTAACTCGAGTTACGTATGGGTTTCACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019648.2-492s1c1
Sequence:CCGGCCCAAAGGACAAGAGTGTGAACTCGAGTTCACACTCTTGTCCTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019648.2-669s1c1
Sequence:CCGGCCTGGGATGACGATGATAGAACTCGAGTTCTATCATCGTCATCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)