EMAIL THIS PAGE TO A FRIEND

METRN

meteorin, glial cell differentiation regulator

54 Gene Product Result for
Synonyms: C16orf23 c380A1.2
UniProtKB ID: Q9UJH8, Q9UJH9
Gene ID:
Human(79006) Summary: Meteorin regulates glial cell differentiation and promotes the formation of axonal networks during neurogenesis (Nishino et al., 2004 [PubMed 15085178]
Mouse(70083) meteorin, glial cell differentiation regulator
Rat(287151) meteorin, glial cell differentiation regulator
Zebrafish(494493) meteorin, glial cell differentiation regulator
domestic cat(101092075) meteorin, glial cell differentiation regulator
cow(515528) meteorin, glial cell differentiation regulator
chicken(427650) meteorin, glial cell differentiation regulator
domestic guinea pig(100721286) meteorin, glial cell differentiation regulator
naked mole-rat(101704939) meteorin, glial cell differentiation regulator
sheep(101110897) meteorin, glial cell differentiation regulator
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA051164 Anti-METRN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

ELISA

Product # Description Species Add to Cart
 
RAB0828 Mouse Metrn / Meteorin ELISA Kit mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133719 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133719 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133719 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024042 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024042 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024042 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042461 MISSION® esiRNA esiRNA human METRN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024042 Rosetta Predictions human pricing
NM_001009962 Rosetta Predictions rat pricing
XM_579319 Rosetta Predictions rat pricing
NM_133719 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024042 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158973 predicted 673
2 SASI_Hs02_00356476 predicted 722
3 SASI_Hs01_00158974 predicted 668
4 SASI_Hs01_00158975 predicted 599
5 SASI_Hs01_00158977 predicted 384
6 SASI_Hs01_00158978 predicted 748
7 SASI_Hs02_00356477 predicted 858
8 SASI_Hs01_00158979 predicted 341
9 SASI_Hs01_00158981 predicted 762
10 SASI_Hs01_00158982 predicted 554
11 SASI_Hs01_00158976 predicted 865
12 SASI_Hs01_00158980 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009962 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103530 predicted 418
2 SASI_Rn01_00103531 predicted 609
3 SASI_Rn01_00103532 predicted 556
4 SASI_Rn01_00103533 predicted 250
5 SASI_Rn01_00103534 predicted 238
6 SASI_Rn01_00103535 predicted 273
7 SASI_Rn01_00103536 predicted 406
8 SASI_Rn01_00103537 predicted 526
9 SASI_Rn01_00103538 predicted 610
10 SASI_Rn01_00103539 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579319 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00154287 predicted 612
2 SASI_Rn01_00154288 predicted 703
3 SASI_Rn01_00154289 predicted 563
4 SASI_Rn01_00154290 predicted 695
5 SASI_Rn01_00154291 predicted 611
6 SASI_Rn01_00154292 predicted 641
7 SASI_Rn01_00154293 predicted 607
8 SASI_Rn01_00154294 predicted 542
9 SASI_Rn01_00154295 predicted 552
10 SASI_Rn01_00154296 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133719 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137245 predicted 494
2 SASI_Mm01_00137246 predicted 883
3 SASI_Mm01_00137247 predicted 1071
4 SASI_Mm01_00137248 predicted 204
5 SASI_Mm01_00137249 predicted 1066
6 SASI_Mm01_00137250 predicted 972
7 SASI_Mm01_00137251 predicted 1066
8 SASI_Mm01_00137252 predicted 930
9 SASI_Mm01_00137253 predicted 309
10 SASI_Mm02_00338689 predicted 373
11 SASI_Mm01_00137244 predicted 501
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133719
METRN MISSION shRNA Bacterial Glycerol Stock
meteorin, glial cell differentiation regulator
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133719.2-366s21c1
Sequence:CCGGGAACGTATGACCGGCAATCTACTCGAGTAGATTGCCGGTCATACGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133719.2-674s21c1
Sequence:CCGGTGACACAGAGCTGCAAGAATCCTCGAGGATTCTTGCAGCTCTGTGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133719.2-890s21c1
Sequence:CCGGAGAGTTCAGCCGTGTCTATTCCTCGAGGAATAGACACGGCTGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133719.2-834s21c1
Sequence:CCGGTTCATGGGCTGGAGCCGATTTCTCGAGAAATCGGCTCCAGCCCATGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133719.2-1076s21c1
Sequence:CCGGGCTGGTAGAATACTAAGTAATCTCGAGATTACTTAGTATTCTACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133719.1-684s1c1
Sequence:CCGGCTGCAAGAATCAGTCATCACTCTCGAGAGTGATGACTGATTCTTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133719.1-366s1c1
Sequence:CCGGGAACGTATGACCGGCAATCTACTCGAGTAGATTGCCGGTCATACGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133719.1-926s1c1
Sequence:CCGGCCATCTCAACCCATGTGAGATCTCGAGATCTCACATGGGTTGAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133719
METRN MISSION shRNA shRNA Plasmid DNA
meteorin, glial cell differentiation regulator
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133719.2-366s21c1
Sequence:CCGGGAACGTATGACCGGCAATCTACTCGAGTAGATTGCCGGTCATACGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133719.2-674s21c1
Sequence:CCGGTGACACAGAGCTGCAAGAATCCTCGAGGATTCTTGCAGCTCTGTGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133719.2-890s21c1
Sequence:CCGGAGAGTTCAGCCGTGTCTATTCCTCGAGGAATAGACACGGCTGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133719.2-834s21c1
Sequence:CCGGTTCATGGGCTGGAGCCGATTTCTCGAGAAATCGGCTCCAGCCCATGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133719.2-1076s21c1
Sequence:CCGGGCTGGTAGAATACTAAGTAATCTCGAGATTACTTAGTATTCTACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133719.1-684s1c1
Sequence:CCGGCTGCAAGAATCAGTCATCACTCTCGAGAGTGATGACTGATTCTTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133719.1-366s1c1
Sequence:CCGGGAACGTATGACCGGCAATCTACTCGAGTAGATTGCCGGTCATACGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133719.1-926s1c1
Sequence:CCGGCCATCTCAACCCATGTGAGATCTCGAGATCTCACATGGGTTGAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133719
METRN MISSION shRNA Lentiviral Transduction Particles
meteorin, glial cell differentiation regulator
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133719.2-366s21c1
Sequence:CCGGGAACGTATGACCGGCAATCTACTCGAGTAGATTGCCGGTCATACGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133719.2-674s21c1
Sequence:CCGGTGACACAGAGCTGCAAGAATCCTCGAGGATTCTTGCAGCTCTGTGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133719.2-890s21c1
Sequence:CCGGAGAGTTCAGCCGTGTCTATTCCTCGAGGAATAGACACGGCTGAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133719.2-834s21c1
Sequence:CCGGTTCATGGGCTGGAGCCGATTTCTCGAGAAATCGGCTCCAGCCCATGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133719.2-1076s21c1
Sequence:CCGGGCTGGTAGAATACTAAGTAATCTCGAGATTACTTAGTATTCTACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133719.1-684s1c1
Sequence:CCGGCTGCAAGAATCAGTCATCACTCTCGAGAGTGATGACTGATTCTTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133719.1-366s1c1
Sequence:CCGGGAACGTATGACCGGCAATCTACTCGAGTAGATTGCCGGTCATACGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133719.1-926s1c1
Sequence:CCGGCCATCTCAACCCATGTGAGATCTCGAGATCTCACATGGGTTGAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024042
VALIDATED
METRN MISSION shRNA Bacterial Glycerol Stock
meteorin, glial cell differentiation regulator
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024042.2-675s1c1
Sequence:CCGGCGACTTCGTAATTCACGGGATCTCGAGATCCCGTGAATTACGAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024042.2-667s1c1
Sequence:CCGGTGCACCAGCGACTTCGTAATTCTCGAGAATTACGAAGTCGCTGGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_024042.2-552s1c1
Sequence:CCGGCTTCCGCTTTGAGCTGCGCGACTCGAGTCGCGCAGCTCAAAGCGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_024042.2-283s1c1
Sequence:CCGGGTTGAGTGGCTGTACCCGGCTCTCGAGAGCCGGGTACAGCCACTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024042.2-724s1c1
Sequence:CCGGCTGCAGGAGTCTGTCATCACTCTCGAGAGTGATGACAGACTCCTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024042
VALIDATED
METRN MISSION shRNA shRNA Plasmid DNA
meteorin, glial cell differentiation regulator
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024042.2-675s1c1
Sequence:CCGGCGACTTCGTAATTCACGGGATCTCGAGATCCCGTGAATTACGAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024042.2-667s1c1
Sequence:CCGGTGCACCAGCGACTTCGTAATTCTCGAGAATTACGAAGTCGCTGGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_024042.2-552s1c1
Sequence:CCGGCTTCCGCTTTGAGCTGCGCGACTCGAGTCGCGCAGCTCAAAGCGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_024042.2-283s1c1
Sequence:CCGGGTTGAGTGGCTGTACCCGGCTCTCGAGAGCCGGGTACAGCCACTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024042.2-724s1c1
Sequence:CCGGCTGCAGGAGTCTGTCATCACTCTCGAGAGTGATGACAGACTCCTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024042
VALIDATED
METRN MISSION shRNA Lentiviral Transduction Particles
meteorin, glial cell differentiation regulator
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024042.2-675s1c1
Sequence:CCGGCGACTTCGTAATTCACGGGATCTCGAGATCCCGTGAATTACGAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024042.2-667s1c1
Sequence:CCGGTGCACCAGCGACTTCGTAATTCTCGAGAATTACGAAGTCGCTGGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_024042.2-552s1c1
Sequence:CCGGCTTCCGCTTTGAGCTGCGCGACTCGAGTCGCGCAGCTCAAAGCGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_024042.2-283s1c1
Sequence:CCGGGTTGAGTGGCTGTACCCGGCTCTCGAGAGCCGGGTACAGCCACTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024042.2-724s1c1
Sequence:CCGGCTGCAGGAGTCTGTCATCACTCTCGAGAGTGATGACAGACTCCTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)