EMAIL THIS PAGE TO A FRIEND

METRNL

meteorin, glial cell differentiation regulator-like

48 Gene Product Result for
UniProtKB ID: Q641Q3, Q86VM0
Gene ID:
Mouse(210029) meteorin, glial cell differentiation regulator-like
Rat(316842) meteorin, glial cell differentiation regulator-like
sheep(101103741) meteorin, glial cell differentiation regulator-like
naked mole-rat(101712560) meteorin, glial cell differentiation regulator-like
domestic guinea pig(100719111) meteorin, glial cell differentiation regulator-like
Zebrafish(406258) meteorin, glial cell differentiation regulator-like
cow(534297) meteorin, glial cell differentiation regulator-like
domestic cat(101084587) meteorin, glial cell differentiation regulator-like
dog(608424) meteorin, glial cell differentiation regulator-like
chicken(417332) meteorin, glial cell differentiation regulator-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144797 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144797 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144797 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_209073 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_209073 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_209073 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001004431 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004431 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004431 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004431 Rosetta Predictions human pricing
NM_001014104 Rosetta Predictions rat pricing
NM_144797 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171300 predicted 433
2 SASI_Hs01_00171301 predicted 808
3 SASI_Hs01_00171302 predicted 875
4 SASI_Hs01_00171303 predicted 974
5 SASI_Hs01_00171304 predicted 1024
6 SASI_Hs01_00171305 predicted 618
7 SASI_Hs01_00171306 predicted 982
8 SASI_Hs01_00171307 predicted 435
9 SASI_Hs01_00171308 predicted 1035
10 SASI_Hs01_00171309 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014104 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077376 predicted 1051
2 SASI_Rn01_00077377 predicted 792
3 SASI_Rn01_00077378 predicted 894
4 SASI_Rn01_00077379 predicted 640
5 SASI_Rn01_00077380 predicted 1124
6 SASI_Rn01_00077381 predicted 1093
7 SASI_Rn02_00201541 predicted 831
8 SASI_Rn01_00077383 predicted 1120
9 SASI_Rn01_00077385 predicted 726
10 SASI_Rn02_00201542 predicted 629
11 SASI_Rn01_00077382 predicted 634
12 SASI_Rn01_00077384 predicted 972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144797 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058497 predicted 537
2 SASI_Mm01_00058498 predicted 642
3 SASI_Mm01_00058499 predicted 578
4 SASI_Mm01_00058500 predicted 800
5 SASI_Mm01_00058501 predicted 1613
6 SASI_Mm01_00058503 predicted 1054
7 SASI_Mm02_00340140 predicted 832
8 SASI_Mm01_00058505 predicted 1125
9 SASI_Mm02_00340141 predicted 796
10 SASI_Mm02_00340142 predicted 535
11 SASI_Mm01_00058502 predicted 536
12 SASI_Mm01_00058504 predicted 396
13 SASI_Mm01_00058506 predicted 1565
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144797
VALIDATED
METRNL MISSION shRNA Bacterial Glycerol Stock
meteorin, glial cell differentiation regulator-like
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144797.3-537s21c1
Sequence:CCGGACTCCTCTGGAGCCAATATTTCTCGAGAAATATTGGCTCCAGAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144797.2-2284s1c1
Sequence:CCGGCGGAGAAAGATTCAATGGTTACTCGAGTAACCATTGAATCTTTCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144797.3-836s21c1
Sequence:CCGGGACGTCACACATGTACCAGAACTCGAGTTCTGGTACATGTGTGACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144797.3-502s21c1
Sequence:CCGGCCAGAACTTGACTGTGTGCATCTCGAGATGCACACAGTCAAGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144797.2-837s1c1
Sequence:CCGGGACGTCACACATGTACCAGAACTCGAGTTCTGGTACATGTGTGACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144797.2-1057s1c1
Sequence:CCGGCACGCTTTAGTGACTTTCAAACTCGAGTTTGAAAGTCACTAAAGCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144797.2-503s1c1
Sequence:CCGGCCAGAACTTGACTGTGTGCATCTCGAGATGCACACAGTCAAGTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144797.2-700s1c1
Sequence:CCGGGCTTCCAGTATGAGCTGATGACTCGAGTCATCAGCTCATACTGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144797.3-699s21c1
Sequence:CCGGGCTTCCAGTATGAGCTGATGACTCGAGTCATCAGCTCATACTGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144797
VALIDATED
METRNL MISSION shRNA shRNA Plasmid DNA
meteorin, glial cell differentiation regulator-like
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144797.3-537s21c1
Sequence:CCGGACTCCTCTGGAGCCAATATTTCTCGAGAAATATTGGCTCCAGAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144797.2-2284s1c1
Sequence:CCGGCGGAGAAAGATTCAATGGTTACTCGAGTAACCATTGAATCTTTCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144797.3-836s21c1
Sequence:CCGGGACGTCACACATGTACCAGAACTCGAGTTCTGGTACATGTGTGACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144797.3-502s21c1
Sequence:CCGGCCAGAACTTGACTGTGTGCATCTCGAGATGCACACAGTCAAGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144797.2-837s1c1
Sequence:CCGGGACGTCACACATGTACCAGAACTCGAGTTCTGGTACATGTGTGACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144797.2-1057s1c1
Sequence:CCGGCACGCTTTAGTGACTTTCAAACTCGAGTTTGAAAGTCACTAAAGCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144797.2-503s1c1
Sequence:CCGGCCAGAACTTGACTGTGTGCATCTCGAGATGCACACAGTCAAGTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144797.2-700s1c1
Sequence:CCGGGCTTCCAGTATGAGCTGATGACTCGAGTCATCAGCTCATACTGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144797.3-699s21c1
Sequence:CCGGGCTTCCAGTATGAGCTGATGACTCGAGTCATCAGCTCATACTGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144797
VALIDATED
METRNL MISSION shRNA Lentiviral Transduction Particles
meteorin, glial cell differentiation regulator-like
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144797.3-537s21c1
Sequence:CCGGACTCCTCTGGAGCCAATATTTCTCGAGAAATATTGGCTCCAGAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144797.2-2284s1c1
Sequence:CCGGCGGAGAAAGATTCAATGGTTACTCGAGTAACCATTGAATCTTTCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144797.3-836s21c1
Sequence:CCGGGACGTCACACATGTACCAGAACTCGAGTTCTGGTACATGTGTGACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144797.3-502s21c1
Sequence:CCGGCCAGAACTTGACTGTGTGCATCTCGAGATGCACACAGTCAAGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144797.2-837s1c1
Sequence:CCGGGACGTCACACATGTACCAGAACTCGAGTTCTGGTACATGTGTGACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144797.2-1057s1c1
Sequence:CCGGCACGCTTTAGTGACTTTCAAACTCGAGTTTGAAAGTCACTAAAGCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144797.2-503s1c1
Sequence:CCGGCCAGAACTTGACTGTGTGCATCTCGAGATGCACACAGTCAAGTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144797.2-700s1c1
Sequence:CCGGGCTTCCAGTATGAGCTGATGACTCGAGTCATCAGCTCATACTGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144797.3-699s21c1
Sequence:CCGGGCTTCCAGTATGAGCTGATGACTCGAGTCATCAGCTCATACTGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_209073
VALIDATED
METRNL MISSION shRNA Bacterial Glycerol Stock
meteorin, glial cell differentiation regulator-like
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000188187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_209073.5-348s1c1
Sequence:CCGGCAACAGGTGCTCTCATCGTTACTCGAGTAACGATGAGAGCACCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_209073.5-1282s1c1
Sequence:CCGGGAAATGTCCATAGGAAACAAACTCGAGTTTGTTTCCTATGGACATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_209073.5-955s1c1
Sequence:CCGGCTTCAAGGACTTCCAGAGGATCTCGAGATCCTCTGGAAGTCCTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_209073
VALIDATED
METRNL MISSION shRNA shRNA Plasmid DNA
meteorin, glial cell differentiation regulator-like
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000188187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_209073.5-348s1c1
Sequence:CCGGCAACAGGTGCTCTCATCGTTACTCGAGTAACGATGAGAGCACCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_209073.5-1282s1c1
Sequence:CCGGGAAATGTCCATAGGAAACAAACTCGAGTTTGTTTCCTATGGACATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_209073.5-955s1c1
Sequence:CCGGCTTCAAGGACTTCCAGAGGATCTCGAGATCCTCTGGAAGTCCTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_209073
VALIDATED
METRNL MISSION shRNA Lentiviral Transduction Particles
meteorin, glial cell differentiation regulator-like
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000188187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_209073.5-348s1c1
Sequence:CCGGCAACAGGTGCTCTCATCGTTACTCGAGTAACGATGAGAGCACCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_209073.5-1282s1c1
Sequence:CCGGGAAATGTCCATAGGAAACAAACTCGAGTTTGTTTCCTATGGACATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_209073.5-955s1c1
Sequence:CCGGCTTCAAGGACTTCCAGAGGATCTCGAGATCCTCTGGAAGTCCTTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004431
VALIDATED
METRNL MISSION shRNA Bacterial Glycerol Stock
meteorin, glial cell differentiation regulator-like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004431.1-1072s1c1
Sequence:CCGGCGCTGCCCTTCCTCTCCTGATCTCGAGATCAGGAGAGGAAGGGCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001004431.1-753s21c1
Sequence:CCGGTCCATCCAGCAAGTTACCCACCTCGAGGTGGGTAACTTGCTGGATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001004431.1-381s21c1
Sequence:CCGGACAGGTGCTCTCATCGTTAACCTCGAGGTTAACGATGAGAGCACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001004431.1-989s21c1
Sequence:CCGGCAAGGACTTCCAGAGGATGTACTCGAGTACATCCTCTGGAAGTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004431.1-626s21c1
Sequence:CCGGCTTCCAGTACGAGCTGGTTAGCTCGAGCTAACCAGCTCGTACTGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001004431.1-930s21c1
Sequence:CCGGTTCCTCTTCACTGGCCACATGCTCGAGCATGTGGCCAGTGAAGAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001004431.1-813s21c1
Sequence:CCGGAGCAGACTCTATCGGCAGAAACTCGAGTTTCTGCCGATAGAGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004431
VALIDATED
METRNL MISSION shRNA shRNA Plasmid DNA
meteorin, glial cell differentiation regulator-like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004431.1-1072s1c1
Sequence:CCGGCGCTGCCCTTCCTCTCCTGATCTCGAGATCAGGAGAGGAAGGGCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001004431.1-753s21c1
Sequence:CCGGTCCATCCAGCAAGTTACCCACCTCGAGGTGGGTAACTTGCTGGATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001004431.1-381s21c1
Sequence:CCGGACAGGTGCTCTCATCGTTAACCTCGAGGTTAACGATGAGAGCACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001004431.1-989s21c1
Sequence:CCGGCAAGGACTTCCAGAGGATGTACTCGAGTACATCCTCTGGAAGTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004431.1-626s21c1
Sequence:CCGGCTTCCAGTACGAGCTGGTTAGCTCGAGCTAACCAGCTCGTACTGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001004431.1-930s21c1
Sequence:CCGGTTCCTCTTCACTGGCCACATGCTCGAGCATGTGGCCAGTGAAGAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001004431.1-813s21c1
Sequence:CCGGAGCAGACTCTATCGGCAGAAACTCGAGTTTCTGCCGATAGAGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004431
VALIDATED
METRNL MISSION shRNA Lentiviral Transduction Particles
meteorin, glial cell differentiation regulator-like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004431.1-1072s1c1
Sequence:CCGGCGCTGCCCTTCCTCTCCTGATCTCGAGATCAGGAGAGGAAGGGCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001004431.1-753s21c1
Sequence:CCGGTCCATCCAGCAAGTTACCCACCTCGAGGTGGGTAACTTGCTGGATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001004431.1-381s21c1
Sequence:CCGGACAGGTGCTCTCATCGTTAACCTCGAGGTTAACGATGAGAGCACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001004431.1-989s21c1
Sequence:CCGGCAAGGACTTCCAGAGGATGTACTCGAGTACATCCTCTGGAAGTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004431.1-626s21c1
Sequence:CCGGCTTCCAGTACGAGCTGGTTAGCTCGAGCTAACCAGCTCGTACTGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001004431.1-930s21c1
Sequence:CCGGTTCCTCTTCACTGGCCACATGCTCGAGCATGTGGCCAGTGAAGAGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001004431.1-813s21c1
Sequence:CCGGAGCAGACTCTATCGGCAGAAACTCGAGTTTCTGCCGATAGAGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)