EMAIL THIS PAGE TO A FRIEND

METTL10

methyltransferase like 10

53 Gene Product Result for
Synonyms: C10orf138 Em:AC068896.3
UniProtKB ID: Q5JPI9, A8MPY7
Gene ID:
Mouse(72096) methyltransferase like 10
Rat(361664) methyltransferase like 10
sheep(101104876) methyltransferase like 10
naked mole-rat(101724958) methyltransferase like 10
domestic guinea pig(100713159) methyltransferase like 10
Zebrafish(503749) methyltransferase like 10
chicken(423955) methyltransferase like 10
domestic cat(101100508) methyltransferase like 10
dog(100685683) methyltransferase like 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_212554 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_212554 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_212554 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028095 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028095 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028095 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103421 MISSION® esiRNA esiRNA human METTL10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_212554 Rosetta Predictions human pricing
NM_001108504 Rosetta Predictions rat pricing
NM_028095 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067118 predicted 337
2 SASI_Hs01_00067120 predicted 1162
3 SASI_Hs01_00067121 predicted 217
4 SASI_Hs02_00374231 predicted 277
5 SASI_Hs01_00067122 predicted 1262
6 SASI_Hs02_00374232 predicted 220
7 SASI_Hs02_00374233 predicted 380
8 SASI_Hs02_00374234 predicted 1259
9 SASI_Hs01_00067123 predicted 1312
10 SASI_Hs01_00067124 predicted 351
11 SASI_Hs01_00067119 predicted 427
12 SASI_Hs01_00067125 predicted 412
13 SASI_Hs01_00067126 predicted 267
14 SASI_Hs01_00067127 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108504 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239299 predicted 660
2 SASI_Rn02_00239300 predicted 752
3 SASI_Rn02_00239301 predicted 642
4 SASI_Rn02_00239302 predicted 633
5 SASI_Rn02_00239303 predicted 847
6 SASI_Rn02_00239304 predicted 660
7 SASI_Rn02_00239305 predicted 847
8 SASI_Rn02_00239306 predicted 781
9 SASI_Rn02_00239307 predicted 796
10 SASI_Rn02_00239308 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028095 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161296 predicted 710
2 SASI_Mm02_00333341 predicted 286
3 SASI_Mm01_00161299 predicted 644
4 SASI_Mm01_00161300 predicted 409
5 SASI_Mm01_00161301 predicted 522
6 SASI_Mm01_00161302 predicted 216
7 SASI_Mm02_00333342 predicted 691
8 SASI_Mm01_00161303 predicted 853
9 SASI_Mm01_00161304 predicted 344
10 SASI_Mm01_00161305 predicted 405
11 SASI_Mm01_00161297 predicted 328
12 SASI_Mm01_00161298 predicted 633
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_212554
VALIDATED
METTL10 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_212554.1-219s1c1
Sequence:CCGGGTTTGGAGAAGAGAGTATGAACTCGAGTTCATACTCTCTTCTCCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_212554.1-383s1c1
Sequence:CCGGCAATTCAGCTTTCTGGAAGTACTCGAGTACTTCCAGAAAGCTGAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212554.1-534s1c1
Sequence:CCGGCAATGCAATTGAGAAGAGGAACTCGAGTTCCTCTTCTCAATTGCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_212554.1-185s1c1
Sequence:CCGGCTTTCCGAGAATATGGAGATACTCGAGTATCTCCATATTCTCGGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_212554.1-359s1c1
Sequence:CCGGCTGGAATTGATTACTCTCCTTCTCGAGAAGGAGAGTAATCAATTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_212554.1-516s1c1
Sequence:CCGGCATAAGCCTTAATCCTGACAACTCGAGTTGTCAGGATTAAGGCTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212554.1-237s1c1
Sequence:CCGGGAATCGACTAATAAGGTGGATCTCGAGATCCACCTTATTAGTCGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_212554.1-178s1c1
Sequence:CCGGCTGCAAACTTTCCGAGAATATCTCGAGATATTCTCGGAAAGTTTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_212554.1-202s1c1
Sequence:CCGGGATACAGGTGAAATCTGGTTTCTCGAGAAACCAGATTTCACCTGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_212554
VALIDATED
METTL10 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_212554.1-219s1c1
Sequence:CCGGGTTTGGAGAAGAGAGTATGAACTCGAGTTCATACTCTCTTCTCCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_212554.1-383s1c1
Sequence:CCGGCAATTCAGCTTTCTGGAAGTACTCGAGTACTTCCAGAAAGCTGAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212554.1-534s1c1
Sequence:CCGGCAATGCAATTGAGAAGAGGAACTCGAGTTCCTCTTCTCAATTGCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_212554.1-185s1c1
Sequence:CCGGCTTTCCGAGAATATGGAGATACTCGAGTATCTCCATATTCTCGGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_212554.1-359s1c1
Sequence:CCGGCTGGAATTGATTACTCTCCTTCTCGAGAAGGAGAGTAATCAATTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_212554.1-516s1c1
Sequence:CCGGCATAAGCCTTAATCCTGACAACTCGAGTTGTCAGGATTAAGGCTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212554.1-237s1c1
Sequence:CCGGGAATCGACTAATAAGGTGGATCTCGAGATCCACCTTATTAGTCGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_212554.1-178s1c1
Sequence:CCGGCTGCAAACTTTCCGAGAATATCTCGAGATATTCTCGGAAAGTTTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_212554.1-202s1c1
Sequence:CCGGGATACAGGTGAAATCTGGTTTCTCGAGAAACCAGATTTCACCTGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_212554
VALIDATED
METTL10 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_212554.1-219s1c1
Sequence:CCGGGTTTGGAGAAGAGAGTATGAACTCGAGTTCATACTCTCTTCTCCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_212554.1-383s1c1
Sequence:CCGGCAATTCAGCTTTCTGGAAGTACTCGAGTACTTCCAGAAAGCTGAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212554.1-534s1c1
Sequence:CCGGCAATGCAATTGAGAAGAGGAACTCGAGTTCCTCTTCTCAATTGCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_212554.1-185s1c1
Sequence:CCGGCTTTCCGAGAATATGGAGATACTCGAGTATCTCCATATTCTCGGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_212554.1-359s1c1
Sequence:CCGGCTGGAATTGATTACTCTCCTTCTCGAGAAGGAGAGTAATCAATTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_212554.1-516s1c1
Sequence:CCGGCATAAGCCTTAATCCTGACAACTCGAGTTGTCAGGATTAAGGCTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212554.1-237s1c1
Sequence:CCGGGAATCGACTAATAAGGTGGATCTCGAGATCCACCTTATTAGTCGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_212554.1-178s1c1
Sequence:CCGGCTGCAAACTTTCCGAGAATATCTCGAGATATTCTCGGAAAGTTTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_212554.1-202s1c1
Sequence:CCGGGATACAGGTGAAATCTGGTTTCTCGAGAAACCAGATTTCACCTGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028095
METTL10 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028095.1-844s1c1
Sequence:CCGGCCAGGCTTAGTAAGTGCAAATCTCGAGATTTGCACTTACTAAGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028095.1-467s1c1
Sequence:CCGGAGCTTTCTGGATTTCATGTTTCTCGAGAAACATGAAATCCAGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028095.1-679s1c1
Sequence:CCGGCCAACACCCAAGTTCAGCTTTCTCGAGAAAGCTGAACTTGGGTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028095.1-288s1c1
Sequence:CCGGGCTTGATATTGGAACTGGAAACTCGAGTTTCCAGTTCCAATATCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028095.1-255s1c1
Sequence:CCGGGCAGAAACACAAGATCCCATTCTCGAGAATGGGATCTTGTGTTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028095
METTL10 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028095.1-844s1c1
Sequence:CCGGCCAGGCTTAGTAAGTGCAAATCTCGAGATTTGCACTTACTAAGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028095.1-467s1c1
Sequence:CCGGAGCTTTCTGGATTTCATGTTTCTCGAGAAACATGAAATCCAGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028095.1-679s1c1
Sequence:CCGGCCAACACCCAAGTTCAGCTTTCTCGAGAAAGCTGAACTTGGGTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028095.1-288s1c1
Sequence:CCGGGCTTGATATTGGAACTGGAAACTCGAGTTTCCAGTTCCAATATCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028095.1-255s1c1
Sequence:CCGGGCAGAAACACAAGATCCCATTCTCGAGAATGGGATCTTGTGTTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028095
METTL10 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028095.1-844s1c1
Sequence:CCGGCCAGGCTTAGTAAGTGCAAATCTCGAGATTTGCACTTACTAAGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028095.1-467s1c1
Sequence:CCGGAGCTTTCTGGATTTCATGTTTCTCGAGAAACATGAAATCCAGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028095.1-679s1c1
Sequence:CCGGCCAACACCCAAGTTCAGCTTTCTCGAGAAAGCTGAACTTGGGTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028095.1-288s1c1
Sequence:CCGGGCTTGATATTGGAACTGGAAACTCGAGTTTCCAGTTCCAATATCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028095.1-255s1c1
Sequence:CCGGGCAGAAACACAAGATCCCATTCTCGAGAATGGGATCTTGTGTTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)