EMAIL THIS PAGE TO A FRIEND

METTL11B

methyltransferase like 11B

86 Gene Product Result for
Synonyms: C1orf184 HOMT1B NTM1B
UniProtKB ID: Q5VVY1, B2RXI0
Gene ID:
Mouse(240879) methyltransferase like 11B
Rat(289167) methyltransferase like 11B
Zebrafish(568419) methyltransferase like 11B
cow(521303) methyltransferase like 11B
domestic cat(101084764) methyltransferase like 11B
dog(490351) methyltransferase like 11B
chicken(429066) methyltransferase like 11B
domestic guinea pig(100718393) methyltransferase like 11B
sheep(101103252) methyltransferase like 11B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001143956 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001143956 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001143956 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_001718898 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001718898 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001718898 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126141 MISSION® esiRNA esiRNA human METTL11B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001718898 Rosetta Predictions human pricing
XM_089281 Rosetta Predictions human pricing
XM_939434 Rosetta Predictions human pricing
XM_001074994 Rosetta Predictions rat pricing
XM_222824 Rosetta Predictions rat pricing
XM_001000586 Rosetta Predictions mouse pricing
XM_136356 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00426999 predicted 610
2 SASI_Hs02_00427000 predicted 501
3 SASI_Hs02_00427001 predicted 614
4 SASI_Hs02_00427002 predicted 572
5 SASI_Hs02_00427003 predicted 534
6 SASI_Hs02_00427004 predicted 614
7 SASI_Hs02_00427005 predicted 479
8 SASI_Hs02_00427006 predicted 586
9 SASI_Hs02_00427007 predicted 551
10 SASI_Hs02_00427008 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_089281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478823 predicted 608
2 SASI_Hs01_00253026 predicted 501
3 SASI_Hs02_00478824 predicted 609
4 SASI_Hs02_00478825 predicted 573
5 SASI_Hs01_00253027 predicted 538
6 SASI_Hs02_00478826 predicted 610
7 SASI_Hs01_00253028 predicted 474
8 SASI_Hs02_00478827 predicted 583
9 SASI_Hs02_00478828 predicted 550
10 SASI_Hs02_00478829 predicted 582
11 SASI_Hs01_00253024 predicted 204
12 SASI_Hs01_00253025 predicted 288
13 SASI_Hs01_00253029 predicted 250
14 SASI_Hs01_00253030 predicted 388
15 SASI_Hs01_00253031 predicted 374
16 SASI_Hs01_00253032 predicted 259
17 SASI_Hs01_00253033 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_939434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00483607 predicted 608
2 SASI_Hs02_00483608 predicted 501
3 SASI_Hs02_00483609 predicted 613
4 SASI_Hs02_00483610 predicted 573
5 SASI_Hs02_00483611 predicted 536
6 SASI_Hs02_00483612 predicted 607
7 SASI_Hs02_00483613 predicted 477
8 SASI_Hs02_00483614 predicted 581
9 SASI_Hs02_00483615 predicted 551
10 SASI_Hs02_00483616 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074994 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348038 predicted 610
2 SASI_Rn02_00348039 predicted 390
3 SASI_Rn02_00348040 predicted 613
4 SASI_Rn02_00348041 predicted 562
5 SASI_Rn02_00348042 predicted 454
6 SASI_Rn02_00348043 predicted 292
7 SASI_Rn02_00348044 predicted 452
8 SASI_Rn02_00348045 predicted 546
9 SASI_Rn02_00348046 predicted 437
10 SASI_Rn02_00348047 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222824 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380927 predicted 610
2 SASI_Rn02_00380928 predicted 382
3 SASI_Rn02_00380929 predicted 607
4 SASI_Rn02_00380930 predicted 566
5 SASI_Rn02_00380931 predicted 456
6 SASI_Rn02_00380932 predicted 298
7 SASI_Rn02_00380933 predicted 454
8 SASI_Rn02_00380934 predicted 543
9 SASI_Rn02_00380935 predicted 431
10 SASI_Rn02_00380936 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000586 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00354739 predicted 714
2 SASI_Mm02_00354740 predicted 513
3 SASI_Mm02_00354741 predicted 197
4 SASI_Mm02_00354742 predicted 672
5 SASI_Mm02_00354743 predicted 714
6 SASI_Mm02_00354744 predicted 300
7 SASI_Mm02_00354745 predicted 568
8 SASI_Mm02_00354746 predicted 724
9 SASI_Mm02_00354747 predicted 572
10 SASI_Mm02_00354748 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_136356 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270111 predicted 718
2 SASI_Mm01_00270112 predicted 640
3 SASI_Mm01_00270113 predicted 674
4 SASI_Mm01_00270114 predicted 716
5 SASI_Mm01_00270115 predicted 637
6 SASI_Mm01_00270116 predicted 703
7 SASI_Mm01_00270117 predicted 633
8 SASI_Mm01_00270118 predicted 656
9 SASI_Mm01_00270119 predicted 663
10 SASI_Mm01_00270120 predicted 719
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001143956
METTL11B MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 11B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143956.1-660s21c1
Sequence:CCGGTAACGAGGACAAAGTTGAAAGCTCGAGCTTTCAACTTTGTCCTCGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143956.1-365s21c1
Sequence:CCGGATGGTGAGATGCAGTTCTATGCTCGAGCATAGAACTGCATCTCACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143956.1-243s21c1
Sequence:CCGGTCGTCATAGCATGTCCTTTATCTCGAGATAAAGGACATGCTATGACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143956.1-469s21c1
Sequence:CCGGATCCAAGCCTCTCGTGAATTTCTCGAGAAATTCACGAGAGGCTTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143956.1-827s21c1
Sequence:CCGGTTATCATACTGAAGGACAATGCTCGAGCATTGTCCTTCAGTATGATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001143956
METTL11B MISSION shRNA shRNA Plasmid DNA
methyltransferase like 11B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143956.1-660s21c1
Sequence:CCGGTAACGAGGACAAAGTTGAAAGCTCGAGCTTTCAACTTTGTCCTCGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143956.1-365s21c1
Sequence:CCGGATGGTGAGATGCAGTTCTATGCTCGAGCATAGAACTGCATCTCACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143956.1-243s21c1
Sequence:CCGGTCGTCATAGCATGTCCTTTATCTCGAGATAAAGGACATGCTATGACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143956.1-469s21c1
Sequence:CCGGATCCAAGCCTCTCGTGAATTTCTCGAGAAATTCACGAGAGGCTTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143956.1-827s21c1
Sequence:CCGGTTATCATACTGAAGGACAATGCTCGAGCATTGTCCTTCAGTATGATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001143956
METTL11B MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 11B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143956.1-660s21c1
Sequence:CCGGTAACGAGGACAAAGTTGAAAGCTCGAGCTTTCAACTTTGTCCTCGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143956.1-365s21c1
Sequence:CCGGATGGTGAGATGCAGTTCTATGCTCGAGCATAGAACTGCATCTCACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143956.1-243s21c1
Sequence:CCGGTCGTCATAGCATGTCCTTTATCTCGAGATAAAGGACATGCTATGACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143956.1-469s21c1
Sequence:CCGGATCCAAGCCTCTCGTGAATTTCTCGAGAAATTCACGAGAGGCTTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143956.1-827s21c1
Sequence:CCGGTTATCATACTGAAGGACAATGCTCGAGCATTGTCCTTCAGTATGATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001718898
METTL11B MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 11B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718898.1-477s21c1
Sequence:GTACCGGCAAAGGTGACAAAGTAGAAAGCTCGAGCTTTCTACTTTGTCACCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718898.1-249s21c1
Sequence:GTACCGGAGAGGGTATGATGGGAAATTTCTCGAGAAATTTCCCATCATACCCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718898.1-380s21c1
Sequence:CCGGGGGTCAGCAAACACGTCTTATCTCGAGATAAGACGTGTTTGCTGACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718898.1-152s21c1
Sequence:CCGGTGGTGAAATTGTACGCTTTAACTCGAGTTAAAGCGTACAATTTCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718898.1-54s21c1
Sequence:CCGGCGATGAACTCTGTAGACATAGCTCGAGCTATGTCTACAGAGTTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001718898
METTL11B MISSION shRNA shRNA Plasmid DNA
methyltransferase like 11B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718898.1-477s21c1
Sequence:GTACCGGCAAAGGTGACAAAGTAGAAAGCTCGAGCTTTCTACTTTGTCACCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718898.1-249s21c1
Sequence:GTACCGGAGAGGGTATGATGGGAAATTTCTCGAGAAATTTCCCATCATACCCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718898.1-380s21c1
Sequence:CCGGGGGTCAGCAAACACGTCTTATCTCGAGATAAGACGTGTTTGCTGACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718898.1-152s21c1
Sequence:CCGGTGGTGAAATTGTACGCTTTAACTCGAGTTAAAGCGTACAATTTCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718898.1-54s21c1
Sequence:CCGGCGATGAACTCTGTAGACATAGCTCGAGCTATGTCTACAGAGTTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001718898
METTL11B MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 11B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718898.1-477s21c1
Sequence:GTACCGGCAAAGGTGACAAAGTAGAAAGCTCGAGCTTTCTACTTTGTCACCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718898.1-249s21c1
Sequence:GTACCGGAGAGGGTATGATGGGAAATTTCTCGAGAAATTTCCCATCATACCCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718898.1-380s21c1
Sequence:CCGGGGGTCAGCAAACACGTCTTATCTCGAGATAAGACGTGTTTGCTGACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718898.1-152s21c1
Sequence:CCGGTGGTGAAATTGTACGCTTTAACTCGAGTTAAAGCGTACAATTTCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718898.1-54s21c1
Sequence:CCGGCGATGAACTCTGTAGACATAGCTCGAGCTATGTCTACAGAGTTCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)