EMAIL THIS PAGE TO A FRIEND

METTL12

methyltransferase like 12

16 Gene Product Result for
Synonyms: U99HG
UniProtKB ID: A8MUP2, B7Z4C1
Gene ID:
sheep(101112860) methyltransferase like 12
domestic guinea pig(100735086) methyltransferase like 12
naked mole-rat(101723144) methyltransferase like 12
dog(100682677) methyltransferase like 12
cow(512401) methyltransferase like 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001043229 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001043229 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001043229 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103081 MISSION® esiRNA esiRNA human AP001458.6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001043229 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001043229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311241 predicted 788
2 SASI_Hs02_00311242 predicted 779
3 SASI_Hs02_00311243 predicted 534
4 SASI_Hs02_00311244 predicted 779
5 SASI_Hs02_00311245 predicted 517
6 SASI_Hs02_00311246 predicted 524
7 SASI_Hs02_00311247 predicted 794
8 SASI_Hs02_00311248 predicted 333
9 SASI_Hs02_00311249 predicted 798
10 SASI_Hs02_00311250 predicted 526
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001043229
METTL12 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 12
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001043229.1-805s21c1
Sequence:CCGGAGAATGCTTGAGGGTTCTAAACTCGAGTTTAGAACCCTCAAGCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001043229.1-528s21c1
Sequence:CCGGGTACAGGCCTCTACACCAAATCTCGAGATTTGGTGTAGAGGCCTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001043229.1-992s21c1
Sequence:CCGGAGTAGTCCTGACCCTAGTATTCTCGAGAATACTAGGGTCAGGACTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001043229.1-729s21c1
Sequence:CCGGTCCAACTACTGCTGGACAAAGCTCGAGCTTTGTCCAGCAGTAGTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001043229.1-963s21c1
Sequence:CCGGTGATTCAAGGCTCTCATTAAACTCGAGTTTAATGAGAGCCTTGAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001043229
METTL12 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 12
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001043229.1-805s21c1
Sequence:CCGGAGAATGCTTGAGGGTTCTAAACTCGAGTTTAGAACCCTCAAGCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001043229.1-528s21c1
Sequence:CCGGGTACAGGCCTCTACACCAAATCTCGAGATTTGGTGTAGAGGCCTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001043229.1-992s21c1
Sequence:CCGGAGTAGTCCTGACCCTAGTATTCTCGAGAATACTAGGGTCAGGACTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001043229.1-729s21c1
Sequence:CCGGTCCAACTACTGCTGGACAAAGCTCGAGCTTTGTCCAGCAGTAGTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001043229.1-963s21c1
Sequence:CCGGTGATTCAAGGCTCTCATTAAACTCGAGTTTAATGAGAGCCTTGAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001043229
METTL12 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 12
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001043229.1-805s21c1
Sequence:CCGGAGAATGCTTGAGGGTTCTAAACTCGAGTTTAGAACCCTCAAGCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001043229.1-528s21c1
Sequence:CCGGGTACAGGCCTCTACACCAAATCTCGAGATTTGGTGTAGAGGCCTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001043229.1-992s21c1
Sequence:CCGGAGTAGTCCTGACCCTAGTATTCTCGAGAATACTAGGGTCAGGACTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001043229.1-729s21c1
Sequence:CCGGTCCAACTACTGCTGGACAAAGCTCGAGCTTTGTCCAGCAGTAGTTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001043229.1-963s21c1
Sequence:CCGGTGATTCAAGGCTCTCATTAAACTCGAGTTTAATGAGAGCCTTGAATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)