EMAIL THIS PAGE TO A FRIEND

METTL13

methyltransferase like 13

75 Gene Product Result for
Synonyms: 5630401D24Rik KIAA0859 feat
Gene ID:
Mouse(71449) methyltransferase like 13
Rat(289159) methyltransferase like 13
Zebrafish(557908) methyltransferase like 13
chicken(100857481) methyltransferase like 13
cow(538472) methyltransferase like 13
domestic cat(101088296) methyltransferase like 13
dog(490342) methyltransferase like 13
naked mole-rat(101701287) methyltransferase like 13
Domestic Rabbit(100342720) methyltransferase like 13
domestic guinea pig(100720169) methyltransferase like 13
sheep(101106537) methyltransferase like 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014955 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014955 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014955 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144877 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144877 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144877 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007239 Rosetta Predictions human pricing
NM_014955 Rosetta Predictions human pricing
NM_015935 Rosetta Predictions human pricing
NM_001134501 Rosetta Predictions rat pricing
NM_144877 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007239 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064960 predicted 1276
2 SASI_Hs01_00064963 predicted 1573
3 SASI_Hs01_00064964 predicted 1642
4 SASI_Hs01_00064965 predicted 1685
5 SASI_Hs01_00064966 predicted 1938
6 SASI_Hs01_00064967 predicted 1793
7 SASI_Hs01_00064968 predicted 1099
8 SASI_Hs02_00305260 predicted 1790
9 SASI_Hs02_00305261 predicted 1100
10 SASI_Hs01_00064969 predicted 1360
11 SASI_Hs01_00064961 predicted 1112
12 SASI_Hs01_00064962 predicted 1937
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197630 predicted 1418
2 SASI_Hs01_00197633 predicted 1714
3 SASI_Hs01_00197634 predicted 1784
4 SASI_Hs01_00197635 predicted 1832
5 SASI_Hs01_00197636 predicted 2083
6 SASI_Hs01_00197637 predicted 1941
7 SASI_Hs01_00197638 predicted 1244
8 SASI_Hs02_00346634 predicted 1935
9 SASI_Hs02_00346635 predicted 1242
10 SASI_Hs01_00197639 predicted 1505
11 SASI_Hs01_00197631 predicted 1261
12 SASI_Hs01_00197632 predicted 2074
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015935 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106990 predicted 1743
2 SASI_Hs01_00106993 predicted 2044
3 SASI_Hs01_00106994 predicted 2109
4 SASI_Hs01_00106995 predicted 2157
5 SASI_Hs01_00106996 predicted 2414
6 SASI_Hs01_00106997 predicted 2267
7 SASI_Hs01_00106998 predicted 1567
8 SASI_Hs02_00348570 predicted 2266
9 SASI_Hs02_00348571 predicted 1563
10 SASI_Hs01_00106999 predicted 1826
11 SASI_Hs01_00106991 predicted 1590
12 SASI_Hs01_00106992 predicted 2401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134501 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256499 predicted 470
2 SASI_Rn02_00256500 predicted 2440
3 SASI_Rn02_00256501 predicted 2103
4 SASI_Rn02_00256502 predicted 1482
5 SASI_Rn02_00256503 predicted 1838
6 SASI_Rn02_00256504 predicted 1140
7 SASI_Rn02_00256505 predicted 1489
8 SASI_Rn02_00256506 predicted 2017
9 SASI_Rn02_00256507 predicted 2049
10 SASI_Rn02_00256508 predicted 1834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144877 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136652 predicted 410
2 SASI_Mm01_00136653 predicted 1308
3 SASI_Mm01_00136654 predicted 1556
4 SASI_Mm01_00136655 predicted 2131
5 SASI_Mm01_00136656 predicted 293
6 SASI_Mm01_00136657 predicted 957
7 SASI_Mm01_00136658 predicted 1485
8 SASI_Mm01_00136659 predicted 1264
9 SASI_Mm01_00136660 predicted 2153
10 SASI_Mm01_00136661 predicted 1557
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014955
VALIDATED
METTL13 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 13
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014955.2-628s21c1
Sequence:CCGGGCCTGTCTTTGCCTTCATCATCTCGAGATGATGAAGGCAAAGACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014955.2-325s21c1
Sequence:CCGGGAAGATGGACATGACGCAGATCTCGAGATCTGCGTCATGTCCATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014955.2-1791s21c1
Sequence:CCGGCAGCATTTGTGGAGCAATCTTCTCGAGAAGATTGCTCCACAAATGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014955.2-1309s21c1
Sequence:CCGGGCTGAAGGATGTGTCTCACAACTCGAGTTGTGAGACACATCCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014955.1-1659s1c1
Sequence:CCGGGCCTTGCTACGATGTCATAATCTCGAGATTATGACATCGTAGCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014955.1-1897s1c1
Sequence:CCGGGTGAATGAGATCCTGTTCTGTCTCGAGACAGAACAGGATCTCATTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_014955.1-349s1c1
Sequence:CCGGGATGAGGAAGAGAAGACCTTACTCGAGTAAGGTCTTCTCTTCCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014955.1-1730s1c1
Sequence:CCGGCAGCATTTGTGGAGCAATCTTCTCGAGAAGATTGCTCCACAAATGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014955.1-567s1c1
Sequence:CCGGGCCTGTCTTTGCCTTCATCATCTCGAGATGATGAAGGCAAAGACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014955.1-556s1c1
Sequence:CCGGCAGTTCTCCTTGCCTGTCTTTCTCGAGAAAGACAGGCAAGGAGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014955.1-342s1c1
Sequence:CCGGCCTGACAGATGAGGAAGAGAACTCGAGTTCTCTTCCTCATCTGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014955.1-1248s1c1
Sequence:CCGGGCTGAAGGATGTGTCTCACAACTCGAGTTGTGAGACACATCCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014955.1-264s1c1
Sequence:CCGGGAAGATGGACATGACGCAGATCTCGAGATCTGCGTCATGTCCATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014955.1-451s1c1
Sequence:CCGGGCTCACATCCTGAAGAAAGCACTCGAGTGCTTTCTTCAGGATGTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014955.1-1588s1c1
Sequence:CCGGGACCGAATGAAGGTCCACATTCTCGAGAATGTGGACCTTCATTCGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014955.1-987s1c1
Sequence:CCGGGCAGTATGAAAGCATGGACCACTCGAGTGGTCCATGCTTTCATACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014955.1-1344s1c1
Sequence:CCGGGCAGTCCATTGATAAGAGTTACTCGAGTAACTCTTATCAATGGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014955
VALIDATED
METTL13 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 13
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014955.2-628s21c1
Sequence:CCGGGCCTGTCTTTGCCTTCATCATCTCGAGATGATGAAGGCAAAGACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014955.2-325s21c1
Sequence:CCGGGAAGATGGACATGACGCAGATCTCGAGATCTGCGTCATGTCCATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014955.2-1791s21c1
Sequence:CCGGCAGCATTTGTGGAGCAATCTTCTCGAGAAGATTGCTCCACAAATGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014955.2-1309s21c1
Sequence:CCGGGCTGAAGGATGTGTCTCACAACTCGAGTTGTGAGACACATCCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014955.1-1659s1c1
Sequence:CCGGGCCTTGCTACGATGTCATAATCTCGAGATTATGACATCGTAGCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014955.1-1897s1c1
Sequence:CCGGGTGAATGAGATCCTGTTCTGTCTCGAGACAGAACAGGATCTCATTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_014955.1-349s1c1
Sequence:CCGGGATGAGGAAGAGAAGACCTTACTCGAGTAAGGTCTTCTCTTCCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014955.1-1730s1c1
Sequence:CCGGCAGCATTTGTGGAGCAATCTTCTCGAGAAGATTGCTCCACAAATGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014955.1-567s1c1
Sequence:CCGGGCCTGTCTTTGCCTTCATCATCTCGAGATGATGAAGGCAAAGACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014955.1-556s1c1
Sequence:CCGGCAGTTCTCCTTGCCTGTCTTTCTCGAGAAAGACAGGCAAGGAGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014955.1-342s1c1
Sequence:CCGGCCTGACAGATGAGGAAGAGAACTCGAGTTCTCTTCCTCATCTGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014955.1-1248s1c1
Sequence:CCGGGCTGAAGGATGTGTCTCACAACTCGAGTTGTGAGACACATCCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014955.1-264s1c1
Sequence:CCGGGAAGATGGACATGACGCAGATCTCGAGATCTGCGTCATGTCCATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014955.1-451s1c1
Sequence:CCGGGCTCACATCCTGAAGAAAGCACTCGAGTGCTTTCTTCAGGATGTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014955.1-1588s1c1
Sequence:CCGGGACCGAATGAAGGTCCACATTCTCGAGAATGTGGACCTTCATTCGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014955.1-987s1c1
Sequence:CCGGGCAGTATGAAAGCATGGACCACTCGAGTGGTCCATGCTTTCATACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014955.1-1344s1c1
Sequence:CCGGGCAGTCCATTGATAAGAGTTACTCGAGTAACTCTTATCAATGGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014955
VALIDATED
METTL13 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 13
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014955.2-628s21c1
Sequence:CCGGGCCTGTCTTTGCCTTCATCATCTCGAGATGATGAAGGCAAAGACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014955.2-325s21c1
Sequence:CCGGGAAGATGGACATGACGCAGATCTCGAGATCTGCGTCATGTCCATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014955.2-1791s21c1
Sequence:CCGGCAGCATTTGTGGAGCAATCTTCTCGAGAAGATTGCTCCACAAATGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014955.2-1309s21c1
Sequence:CCGGGCTGAAGGATGTGTCTCACAACTCGAGTTGTGAGACACATCCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014955.1-1659s1c1
Sequence:CCGGGCCTTGCTACGATGTCATAATCTCGAGATTATGACATCGTAGCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014955.1-1897s1c1
Sequence:CCGGGTGAATGAGATCCTGTTCTGTCTCGAGACAGAACAGGATCTCATTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_014955.1-349s1c1
Sequence:CCGGGATGAGGAAGAGAAGACCTTACTCGAGTAAGGTCTTCTCTTCCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014955.1-1730s1c1
Sequence:CCGGCAGCATTTGTGGAGCAATCTTCTCGAGAAGATTGCTCCACAAATGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014955.1-567s1c1
Sequence:CCGGGCCTGTCTTTGCCTTCATCATCTCGAGATGATGAAGGCAAAGACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014955.1-556s1c1
Sequence:CCGGCAGTTCTCCTTGCCTGTCTTTCTCGAGAAAGACAGGCAAGGAGAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014955.1-342s1c1
Sequence:CCGGCCTGACAGATGAGGAAGAGAACTCGAGTTCTCTTCCTCATCTGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014955.1-1248s1c1
Sequence:CCGGGCTGAAGGATGTGTCTCACAACTCGAGTTGTGAGACACATCCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014955.1-264s1c1
Sequence:CCGGGAAGATGGACATGACGCAGATCTCGAGATCTGCGTCATGTCCATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014955.1-451s1c1
Sequence:CCGGGCTCACATCCTGAAGAAAGCACTCGAGTGCTTTCTTCAGGATGTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014955.1-1588s1c1
Sequence:CCGGGACCGAATGAAGGTCCACATTCTCGAGAATGTGGACCTTCATTCGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014955.1-987s1c1
Sequence:CCGGGCAGTATGAAAGCATGGACCACTCGAGTGGTCCATGCTTTCATACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014955.1-1344s1c1
Sequence:CCGGGCAGTCCATTGATAAGAGTTACTCGAGTAACTCTTATCAATGGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144877
METTL13 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 13
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144877.1-1617s1c1
Sequence:CCGGCTCTTCGTTCACGATCATTTCCTCGAGGAAATGATCGTGAACGAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144877.1-1782s21c1
Sequence:CCGGCCGCCTCACTATGATGTGATACTCGAGTATCACATCATAGTGAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144877.1-1122s21c1
Sequence:CCGGGCTGGCATGGAAAGCATTCAACTCGAGTTGAATGCTTTCCATGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144877.1-2468s21c1
Sequence:CCGGCCAAGGCTACACAGATATTTACTCGAGTAAATATCTGTGTAGCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144877.1-2019s21c1
Sequence:CCGGGAGGTGAATGAAATCCTGTTTCTCGAGAAACAGGATTTCATTCACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144877.1-2019s1c1
Sequence:CCGGGAGGTGAATGAAATCCTGTTTCTCGAGAAACAGGATTTCATTCACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144877.1-2468s1c1
Sequence:CCGGCCAAGGCTACACAGATATTTACTCGAGTAAATATCTGTGTAGCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144877.1-1782s1c1
Sequence:CCGGCCGCCTCACTATGATGTGATACTCGAGTATCACATCATAGTGAGGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144877.1-1122s1c1
Sequence:CCGGGCTGGCATGGAAAGCATTCAACTCGAGTTGAATGCTTTCCATGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144877.1-1741s1c1
Sequence:CCGGCAGATGGTCTTGACTACATTACTCGAGTAATGTAGTCAAGACCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144877.1-215s1c1
Sequence:CCGGGCACAAATACATAAAGCCCAACTCGAGTTGGGCTTTATGTATTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144877.1-2403s1c1
Sequence:CCGGGCAGAGGCAAATGGATCTTTACTCGAGTAAAGATCCATTTGCCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144877
METTL13 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 13
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144877.1-1617s1c1
Sequence:CCGGCTCTTCGTTCACGATCATTTCCTCGAGGAAATGATCGTGAACGAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144877.1-1782s21c1
Sequence:CCGGCCGCCTCACTATGATGTGATACTCGAGTATCACATCATAGTGAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144877.1-1122s21c1
Sequence:CCGGGCTGGCATGGAAAGCATTCAACTCGAGTTGAATGCTTTCCATGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144877.1-2468s21c1
Sequence:CCGGCCAAGGCTACACAGATATTTACTCGAGTAAATATCTGTGTAGCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144877.1-2019s21c1
Sequence:CCGGGAGGTGAATGAAATCCTGTTTCTCGAGAAACAGGATTTCATTCACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144877.1-2019s1c1
Sequence:CCGGGAGGTGAATGAAATCCTGTTTCTCGAGAAACAGGATTTCATTCACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144877.1-2468s1c1
Sequence:CCGGCCAAGGCTACACAGATATTTACTCGAGTAAATATCTGTGTAGCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144877.1-1782s1c1
Sequence:CCGGCCGCCTCACTATGATGTGATACTCGAGTATCACATCATAGTGAGGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144877.1-1122s1c1
Sequence:CCGGGCTGGCATGGAAAGCATTCAACTCGAGTTGAATGCTTTCCATGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144877.1-1741s1c1
Sequence:CCGGCAGATGGTCTTGACTACATTACTCGAGTAATGTAGTCAAGACCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144877.1-215s1c1
Sequence:CCGGGCACAAATACATAAAGCCCAACTCGAGTTGGGCTTTATGTATTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144877.1-2403s1c1
Sequence:CCGGGCAGAGGCAAATGGATCTTTACTCGAGTAAAGATCCATTTGCCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144877
METTL13 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 13
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144877.1-1617s1c1
Sequence:CCGGCTCTTCGTTCACGATCATTTCCTCGAGGAAATGATCGTGAACGAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144877.1-1782s21c1
Sequence:CCGGCCGCCTCACTATGATGTGATACTCGAGTATCACATCATAGTGAGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144877.1-1122s21c1
Sequence:CCGGGCTGGCATGGAAAGCATTCAACTCGAGTTGAATGCTTTCCATGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144877.1-2468s21c1
Sequence:CCGGCCAAGGCTACACAGATATTTACTCGAGTAAATATCTGTGTAGCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144877.1-2019s21c1
Sequence:CCGGGAGGTGAATGAAATCCTGTTTCTCGAGAAACAGGATTTCATTCACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144877.1-2019s1c1
Sequence:CCGGGAGGTGAATGAAATCCTGTTTCTCGAGAAACAGGATTTCATTCACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144877.1-2468s1c1
Sequence:CCGGCCAAGGCTACACAGATATTTACTCGAGTAAATATCTGTGTAGCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144877.1-1782s1c1
Sequence:CCGGCCGCCTCACTATGATGTGATACTCGAGTATCACATCATAGTGAGGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144877.1-1122s1c1
Sequence:CCGGGCTGGCATGGAAAGCATTCAACTCGAGTTGAATGCTTTCCATGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144877.1-1741s1c1
Sequence:CCGGCAGATGGTCTTGACTACATTACTCGAGTAATGTAGTCAAGACCATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144877.1-215s1c1
Sequence:CCGGGCACAAATACATAAAGCCCAACTCGAGTTGGGCTTTATGTATTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144877.1-2403s1c1
Sequence:CCGGGCAGAGGCAAATGGATCTTTACTCGAGTAAAGATCCATTTGCCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)