EMAIL THIS PAGE TO A FRIEND

METTL14

methyltransferase like 14

50 Gene Product Result for
UniProtKB ID: Q9HCE5, A6NIG1, Q969V2
Gene ID:
Mouse(210529) methyltransferase like 14
Rat(295428) methyltransferase like 14
sheep(101110842) methyltransferase like 14
domestic guinea pig(100719815) methyltransferase like 14
Domestic Rabbit(100340084) methyltransferase like 14
naked mole-rat(101708897) methyltransferase like 14
Zebrafish(404603) methyltransferase like 14
cow(531382) methyltransferase like 14
Horse(100072440) methyltransferase like 14
domestic cat(101094504) methyltransferase like 14
dog(487920) methyltransferase like 14
chicken(422684) methyltransferase like 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_201638 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201638 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201638 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020961 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020961 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020961 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020961 Rosetta Predictions human pricing
NM_001106470 Rosetta Predictions rat pricing
NM_201638 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179440 predicted 1258
2 SASI_Hs01_00179441 predicted 707
3 SASI_Hs02_00354390 predicted 1500
4 SASI_Hs01_00179442 predicted 531
5 SASI_Hs02_00354391 predicted 1416
6 SASI_Hs01_00179443 predicted 613
7 SASI_Hs01_00179444 predicted 1552
8 SASI_Hs01_00179445 predicted 780
9 SASI_Hs01_00179446 predicted 922
10 SASI_Hs01_00179447 predicted 1237
11 SASI_Hs01_00179448 predicted 617
12 SASI_Hs01_00179449 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106470 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219278 predicted 523
2 SASI_Rn02_00219279 predicted 296
3 SASI_Rn02_00219280 predicted 739
4 SASI_Rn02_00219281 predicted 386
5 SASI_Rn02_00219282 predicted 591
6 SASI_Rn02_00219283 predicted 1214
7 SASI_Rn02_00219284 predicted 602
8 SASI_Rn02_00219285 predicted 374
9 SASI_Rn02_00219286 predicted 484
10 SASI_Rn02_00219287 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201638 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071493 predicted 555
2 SASI_Mm01_00071494 predicted 539
3 SASI_Mm01_00071495 predicted 761
4 SASI_Mm02_00351698 predicted 1399
5 SASI_Mm01_00071497 predicted 1151
6 SASI_Mm02_00351699 predicted 324
7 SASI_Mm01_00071498 predicted 245
8 SASI_Mm01_00071499 predicted 1491
9 SASI_Mm01_00071500 predicted 1038
10 SASI_Mm01_00071502 predicted 884
11 SASI_Mm01_00071496 predicted 600
12 SASI_Mm01_00071501 predicted 411
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201638
VALIDATED
METTL14 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201638.1-283s1c1
Sequence:CCGGCTATGATACATCTGCTCCAAACTCGAGTTTGGAGCAGATGTATCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201638.1-559s1c1
Sequence:CCGGCCCTAAACTTAGGGAACTCATCTCGAGATGAGTTCCCTAAGTTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201638.1-210s1c1
Sequence:CCGGGCATTGGTGCTGTGTTAAATACTCGAGTATTTAACACAGCACCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201638.1-1400s1c1
Sequence:CCGGCGGGAAAGAAACCGATCCAATCTCGAGATTGGATCGGTTTCTTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201638.1-1543s1c1
Sequence:CCGGCCCAGCTTGTACTTTGCTTTACTCGAGTAAAGCAAAGTACAAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201638
VALIDATED
METTL14 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201638.1-283s1c1
Sequence:CCGGCTATGATACATCTGCTCCAAACTCGAGTTTGGAGCAGATGTATCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201638.1-559s1c1
Sequence:CCGGCCCTAAACTTAGGGAACTCATCTCGAGATGAGTTCCCTAAGTTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201638.1-210s1c1
Sequence:CCGGGCATTGGTGCTGTGTTAAATACTCGAGTATTTAACACAGCACCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201638.1-1400s1c1
Sequence:CCGGCGGGAAAGAAACCGATCCAATCTCGAGATTGGATCGGTTTCTTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201638.1-1543s1c1
Sequence:CCGGCCCAGCTTGTACTTTGCTTTACTCGAGTAAAGCAAAGTACAAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201638
VALIDATED
METTL14 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201638.1-283s1c1
Sequence:CCGGCTATGATACATCTGCTCCAAACTCGAGTTTGGAGCAGATGTATCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201638.1-559s1c1
Sequence:CCGGCCCTAAACTTAGGGAACTCATCTCGAGATGAGTTCCCTAAGTTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201638.1-210s1c1
Sequence:CCGGGCATTGGTGCTGTGTTAAATACTCGAGTATTTAACACAGCACCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201638.1-1400s1c1
Sequence:CCGGCGGGAAAGAAACCGATCCAATCTCGAGATTGGATCGGTTTCTTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201638.1-1543s1c1
Sequence:CCGGCCCAGCTTGTACTTTGCTTTACTCGAGTAAAGCAAAGTACAAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020961
VALIDATED
METTL14 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 14
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_020961.2-616s1c1
Sequence:CCGGCCATGTACTTACAAGCCGATACTCGAGTATCGGCTTGTAAGTACATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020961.2-1205s1c1
Sequence:CCGGGCTTACAAATAGCAACTACAACTCGAGTTGTAGTTGCTATTTGTAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_020961.2-1035s1c1
Sequence:CCGGGCTAATGTTGACATTGACTTACTCGAGTAAGTCAATGTCAACATTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020961.2-1387s1c1
Sequence:CCGGGCCGTGGACGAGAAAGAAATACTCGAGTATTTCTTTCTCGTCCACGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020961.2-213s1c1
Sequence:CCGGGCCGTGTTAAATAGCAAAGATCTCGAGATCTTTGCTATTTAACACGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020961.2-1138s21c1
Sequence:CCGGGAAGACGCCTTCATCTATTTGCTCGAGCAAATAGATGAAGGCGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020961.2-583s21c1
Sequence:CCGGAGGATGAGTTAATAGCTAAATCTCGAGATTTAGCTATTAACTCATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020961.2-1068s21c1
Sequence:CCGGGAACCTGAAATTGGCAATATACTCGAGTATATTGCCAATTTCAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020961
VALIDATED
METTL14 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 14
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_020961.2-616s1c1
Sequence:CCGGCCATGTACTTACAAGCCGATACTCGAGTATCGGCTTGTAAGTACATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020961.2-1205s1c1
Sequence:CCGGGCTTACAAATAGCAACTACAACTCGAGTTGTAGTTGCTATTTGTAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_020961.2-1035s1c1
Sequence:CCGGGCTAATGTTGACATTGACTTACTCGAGTAAGTCAATGTCAACATTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020961.2-1387s1c1
Sequence:CCGGGCCGTGGACGAGAAAGAAATACTCGAGTATTTCTTTCTCGTCCACGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020961.2-213s1c1
Sequence:CCGGGCCGTGTTAAATAGCAAAGATCTCGAGATCTTTGCTATTTAACACGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020961.2-1138s21c1
Sequence:CCGGGAAGACGCCTTCATCTATTTGCTCGAGCAAATAGATGAAGGCGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020961.2-583s21c1
Sequence:CCGGAGGATGAGTTAATAGCTAAATCTCGAGATTTAGCTATTAACTCATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020961.2-1068s21c1
Sequence:CCGGGAACCTGAAATTGGCAATATACTCGAGTATATTGCCAATTTCAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020961
VALIDATED
METTL14 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 14
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_020961.2-616s1c1
Sequence:CCGGCCATGTACTTACAAGCCGATACTCGAGTATCGGCTTGTAAGTACATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020961.2-1205s1c1
Sequence:CCGGGCTTACAAATAGCAACTACAACTCGAGTTGTAGTTGCTATTTGTAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_020961.2-1035s1c1
Sequence:CCGGGCTAATGTTGACATTGACTTACTCGAGTAAGTCAATGTCAACATTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020961.2-1387s1c1
Sequence:CCGGGCCGTGGACGAGAAAGAAATACTCGAGTATTTCTTTCTCGTCCACGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020961.2-213s1c1
Sequence:CCGGGCCGTGTTAAATAGCAAAGATCTCGAGATCTTTGCTATTTAACACGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020961.2-1138s21c1
Sequence:CCGGGAAGACGCCTTCATCTATTTGCTCGAGCAAATAGATGAAGGCGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020961.2-583s21c1
Sequence:CCGGAGGATGAGTTAATAGCTAAATCTCGAGATTTAGCTATTAACTCATCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020961.2-1068s21c1
Sequence:CCGGGAACCTGAAATTGGCAATATACTCGAGTATATTGCCAATTTCAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)