EMAIL THIS PAGE TO A FRIEND

METTL17

methyltransferase like 17

91 Gene Product Result for
Synonyms: METT11D1
UniProtKB ID: Q9H7H0, Q9BSH1, Q9BZH2, Q9BZH3
Gene ID:
Mouse(52535) methyltransferase like 17
Rat(305845) methyltransferase like 17
Domestic Rabbit(100355814) methyltransferase like 17
naked mole-rat(101721097) methyltransferase like 17
domestic guinea pig(100720633) methyltransferase like 17
sheep(101111807) methyltransferase like 17
Zebrafish(386901) methyltransferase like 17
dog(475396) methyltransferase like 17
domestic cat(101092441) methyltransferase like 17
cow(514880) methyltransferase like 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029990 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001029990 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001029990 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022734 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022734 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022734 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU124781 MISSION® esiRNA esiRNA human METT11D1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029991 Rosetta Predictions human pricing
NM_001029992 Rosetta Predictions human pricing
NM_022734 Rosetta Predictions human pricing
XM_001053790 Rosetta Predictions rat pricing
XM_223974 Rosetta Predictions rat pricing
NM_001029990 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231680 predicted 879
2 SASI_Hs02_00307587 predicted 739
3 SASI_Hs02_00307588 predicted 405
4 SASI_Hs02_00307589 predicted 745
5 SASI_Hs02_00307590 predicted 745
6 SASI_Hs02_00307591 predicted 555
7 SASI_Hs01_00231688 predicted 205
8 SASI_Hs02_00307592 predicted 905
9 SASI_Hs02_00307593 predicted 214
10 SASI_Hs02_00307594 predicted 1031
11 SASI_Hs01_00231679 predicted 935
12 SASI_Hs01_00231681 predicted 202
13 SASI_Hs01_00231682 predicted 961
14 SASI_Hs01_00231683 predicted 1057
15 SASI_Hs01_00231684 predicted 296
16 SASI_Hs01_00231685 predicted 976
17 SASI_Hs01_00231686 predicted 1052
18 SASI_Hs01_00231687 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029992 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021090 predicted 966
2 SASI_Hs01_00021091 predicted 921
3 SASI_Hs01_00021092 predicted 211
4 SASI_Hs01_00021093 predicted 993
5 SASI_Hs01_00021094 predicted 1091
6 SASI_Hs01_00021095 predicted 299
7 SASI_Hs01_00021096 predicted 999
8 SASI_Hs01_00021097 predicted 1084
9 SASI_Hs01_00021098 predicted 801
10 SASI_Hs01_00021099 predicted 218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110019 predicted 879
2 SASI_Hs02_00355965 predicted 744
3 SASI_Hs02_00355966 predicted 404
4 SASI_Hs02_00355967 predicted 752
5 SASI_Hs02_00355968 predicted 747
6 SASI_Hs02_00355969 predicted 552
7 SASI_Hs01_00110027 predicted 211
8 SASI_Hs02_00355970 predicted 911
9 SASI_Hs02_00355971 predicted 219
10 SASI_Hs02_00355972 predicted 1032
11 SASI_Hs01_00110018 predicted 937
12 SASI_Hs01_00110020 predicted 212
13 SASI_Hs01_00110021 predicted 965
14 SASI_Hs01_00110022 predicted 1061
15 SASI_Hs01_00110023 predicted 289
16 SASI_Hs01_00110024 predicted 972
17 SASI_Hs01_00110025 predicted 1050
18 SASI_Hs01_00110026 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053790 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273562 predicted 723
2 SASI_Rn02_00273563 predicted 491
3 SASI_Rn02_00273564 predicted 1142
4 SASI_Rn02_00273565 predicted 755
5 SASI_Rn02_00273566 predicted 799
6 SASI_Rn02_00273567 predicted 699
7 SASI_Rn02_00273568 predicted 512
8 SASI_Rn02_00273569 predicted 878
9 SASI_Rn02_00273570 predicted 248
10 SASI_Rn02_00273571 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223974 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381764 predicted 790
2 SASI_Rn02_00381765 predicted 556
3 SASI_Rn02_00381766 predicted 1206
4 SASI_Rn02_00381767 predicted 823
5 SASI_Rn02_00381768 predicted 870
6 SASI_Rn02_00381769 predicted 764
7 SASI_Rn02_00381770 predicted 580
8 SASI_Rn02_00381771 predicted 952
9 SASI_Rn02_00381772 predicted 314
10 SASI_Rn02_00381773 predicted 982
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029990 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092812 predicted 825
2 SASI_Mm01_00092813 predicted 482
3 SASI_Mm01_00092814 predicted 1209
4 SASI_Mm01_00092815 predicted 818
5 SASI_Mm01_00092816 predicted 482
6 SASI_Mm01_00092817 predicted 944
7 SASI_Mm01_00092818 predicted 1207
8 SASI_Mm01_00092819 predicted 946
9 SASI_Mm01_00092820 predicted 651
10 SASI_Mm01_00092821 predicted 1287
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029990
VALIDATED
METTL17 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 17
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001029990.1-1432s21c1
Sequence:CCGGTGATCGCTCCATCCGAGTTTCCTCGAGGAAACTCGGATGGAGCGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001029990.1-563s21c1
Sequence:CCGGAGAGCTGAGTCTGATCTATATCTCGAGATATAGATCAGACTCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001029990.1-384s21c1
Sequence:CCGGTATCTCTGGAGCCGACATTTACTCGAGTAAATGTCGGCTCCAGAGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001029990.1-1214s21c1
Sequence:CCGGGGAAATATTCTCTATGGTAATCTCGAGATTACCATAGAGAATATTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029990.1-930s1c1
Sequence:CCGGGCTGATCGCATTGAGGTCATTCTCGAGAATGACCTCAATGCGATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029990.1-663s1c1
Sequence:CCGGCCACAGACGTTGATGGACTTTCTCGAGAAAGTCCATCAACGTCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029990
VALIDATED
METTL17 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 17
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001029990.1-1432s21c1
Sequence:CCGGTGATCGCTCCATCCGAGTTTCCTCGAGGAAACTCGGATGGAGCGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001029990.1-563s21c1
Sequence:CCGGAGAGCTGAGTCTGATCTATATCTCGAGATATAGATCAGACTCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001029990.1-384s21c1
Sequence:CCGGTATCTCTGGAGCCGACATTTACTCGAGTAAATGTCGGCTCCAGAGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001029990.1-1214s21c1
Sequence:CCGGGGAAATATTCTCTATGGTAATCTCGAGATTACCATAGAGAATATTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029990.1-930s1c1
Sequence:CCGGGCTGATCGCATTGAGGTCATTCTCGAGAATGACCTCAATGCGATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029990.1-663s1c1
Sequence:CCGGCCACAGACGTTGATGGACTTTCTCGAGAAAGTCCATCAACGTCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029990
VALIDATED
METTL17 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 17
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001029990.1-1432s21c1
Sequence:CCGGTGATCGCTCCATCCGAGTTTCCTCGAGGAAACTCGGATGGAGCGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001029990.1-563s21c1
Sequence:CCGGAGAGCTGAGTCTGATCTATATCTCGAGATATAGATCAGACTCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001029990.1-384s21c1
Sequence:CCGGTATCTCTGGAGCCGACATTTACTCGAGTAAATGTCGGCTCCAGAGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001029990.1-1214s21c1
Sequence:CCGGGGAAATATTCTCTATGGTAATCTCGAGATTACCATAGAGAATATTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029990.1-930s1c1
Sequence:CCGGGCTGATCGCATTGAGGTCATTCTCGAGAATGACCTCAATGCGATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029990.1-663s1c1
Sequence:CCGGCCACAGACGTTGATGGACTTTCTCGAGAAAGTCCATCAACGTCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022734
VALIDATED
METTL17 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 17
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022734.2-398s21c1
Sequence:CCGGGGCTAACGGTGCCCAGTTATTCTCGAGAATAACTGGGCACCGTTAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022734.2-819s21c1
Sequence:CCGGGGCCAGAGCCTACGTGAATATCTCGAGATATTCACGTAGGCTCTGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022734.2-1049s21c1
Sequence:CCGGATGGCGTAAGACAGGTCATTTCTCGAGAAATGACCTGTCTTACGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022734.2-720s21c1
Sequence:CCGGCATGAGATCCGGGCTCGAAATCTCGAGATTTCGAGCCCGGATCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022734.2-293s21c1
Sequence:CCGGCGGAGTGACCCAGGTAGATAACTCGAGTTATCTACCTGGGTCACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022734.1-646s1c1
Sequence:CCGGGCCAGAGCCTACGTGAATATACTCGAGTATATTCACGTAGGCTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022734
VALIDATED
METTL17 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 17
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022734.2-398s21c1
Sequence:CCGGGGCTAACGGTGCCCAGTTATTCTCGAGAATAACTGGGCACCGTTAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022734.2-819s21c1
Sequence:CCGGGGCCAGAGCCTACGTGAATATCTCGAGATATTCACGTAGGCTCTGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022734.2-1049s21c1
Sequence:CCGGATGGCGTAAGACAGGTCATTTCTCGAGAAATGACCTGTCTTACGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022734.2-720s21c1
Sequence:CCGGCATGAGATCCGGGCTCGAAATCTCGAGATTTCGAGCCCGGATCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022734.2-293s21c1
Sequence:CCGGCGGAGTGACCCAGGTAGATAACTCGAGTTATCTACCTGGGTCACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022734.1-646s1c1
Sequence:CCGGGCCAGAGCCTACGTGAATATACTCGAGTATATTCACGTAGGCTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022734
VALIDATED
METTL17 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 17
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022734.2-398s21c1
Sequence:CCGGGGCTAACGGTGCCCAGTTATTCTCGAGAATAACTGGGCACCGTTAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022734.2-819s21c1
Sequence:CCGGGGCCAGAGCCTACGTGAATATCTCGAGATATTCACGTAGGCTCTGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022734.2-1049s21c1
Sequence:CCGGATGGCGTAAGACAGGTCATTTCTCGAGAAATGACCTGTCTTACGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022734.2-720s21c1
Sequence:CCGGCATGAGATCCGGGCTCGAAATCTCGAGATTTCGAGCCCGGATCTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022734.2-293s21c1
Sequence:CCGGCGGAGTGACCCAGGTAGATAACTCGAGTTATCTACCTGGGTCACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022734.1-646s1c1
Sequence:CCGGGCCAGAGCCTACGTGAATATACTCGAGTATATTCACGTAGGCTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)