EMAIL THIS PAGE TO A FRIEND

METTL18

methyltransferase like 18

47 Gene Product Result for
Synonyms: AsTP2 C1orf156 HPM1
UniProtKB ID: O95568, B2R9T5
Gene ID:
Mouse(69962) methyltransferase like 18
Rat(304928) methyltransferase like 18
chicken(424400) methyltransferase like 18
cow(783955) methyltransferase like 18
dog(100685478) methyltransferase like 18
domestic cat(101083823) methyltransferase like 18
sheep(101102324) methyltransferase like 18
domestic guinea pig(100717924) methyltransferase like 18
naked mole-rat(101704658) methyltransferase like 18
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027279 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027279 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027279 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033418 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033418 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033418 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033418 Rosetta Predictions human pricing
NM_001025668 Rosetta Predictions rat pricing
NM_027279 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209466 predicted 806
2 SASI_Hs01_00209468 predicted 1189
3 SASI_Hs01_00209469 predicted 998
4 SASI_Hs01_00209470 predicted 574
5 SASI_Hs01_00209471 predicted 328
6 SASI_Hs02_00361314 predicted 442
7 SASI_Hs01_00209472 predicted 344
8 SASI_Hs01_00209473 predicted 651
9 SASI_Hs01_00209474 predicted 958
10 SASI_Hs01_00209475 predicted 936
11 SASI_Hs01_00209467 predicted 1173
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025668 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118886 predicted 892
2 SASI_Rn01_00118887 predicted 767
3 SASI_Rn01_00118888 predicted 880
4 SASI_Rn01_00118889 predicted 643
5 SASI_Rn01_00118890 predicted 1206
6 SASI_Rn01_00118891 predicted 1016
7 SASI_Rn01_00118892 predicted 743
8 SASI_Rn01_00118893 predicted 1108
9 SASI_Rn01_00118894 predicted 1272
10 SASI_Rn01_00118895 predicted 1014
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027279 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099988 predicted 341
2 SASI_Mm01_00099991 predicted 843
3 SASI_Mm01_00099992 predicted 666
4 SASI_Mm02_00331866 predicted 938
5 SASI_Mm01_00099993 predicted 1188
6 SASI_Mm01_00099994 predicted 772
7 SASI_Mm01_00099996 predicted 971
8 SASI_Mm01_00099997 predicted 610
9 SASI_Mm02_00331867 predicted 390
10 SASI_Mm02_00331868 predicted 488
11 SASI_Mm01_00099989 predicted 763
12 SASI_Mm01_00099990 predicted 1179
13 SASI_Mm01_00099995 predicted 1162
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027279
VALIDATED
METTL18 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 18
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027279.2-378s1c1
Sequence:CCGGCATCCCTCGATGATGGAACTTCTCGAGAAGTTCCATCATCGAGGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027279.2-533s1c1
Sequence:CCGGCCTATTGCTGACAGGTCAGATCTCGAGATCTGACCTGTCAGCAATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027279.2-817s1c1
Sequence:CCGGCCTCTTGACTTACTTCACAAACTCGAGTTTGTGAAGTAAGTCAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027279.2-1119s1c1
Sequence:CCGGGCAAGCTTGTATTACGTGAAACTCGAGTTTCACGTAATACAAGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027279.2-551s21c1
Sequence:CCGGGATGACCCAGAAGCTTGTAAACTCGAGTTTACAAGCTTCTGGGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027279.2-1214s21c1
Sequence:GTACCGGGAAACATTCCTCAGGCTATTACTCGAGTAATAGCCTGAGGAATGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027279.2-965s21c1
Sequence:CCGGGATGAGGTGACCTTACCTAATCTCGAGATTAGGTAAGGTCACCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027279.2-1166s21c1
Sequence:CCGGCTCACTTCAGAAACCATTTATCTCGAGATAAATGGTTTCTGAAGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027279
VALIDATED
METTL18 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 18
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027279.2-378s1c1
Sequence:CCGGCATCCCTCGATGATGGAACTTCTCGAGAAGTTCCATCATCGAGGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027279.2-533s1c1
Sequence:CCGGCCTATTGCTGACAGGTCAGATCTCGAGATCTGACCTGTCAGCAATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027279.2-817s1c1
Sequence:CCGGCCTCTTGACTTACTTCACAAACTCGAGTTTGTGAAGTAAGTCAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027279.2-1119s1c1
Sequence:CCGGGCAAGCTTGTATTACGTGAAACTCGAGTTTCACGTAATACAAGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027279.2-551s21c1
Sequence:CCGGGATGACCCAGAAGCTTGTAAACTCGAGTTTACAAGCTTCTGGGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027279.2-1214s21c1
Sequence:GTACCGGGAAACATTCCTCAGGCTATTACTCGAGTAATAGCCTGAGGAATGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027279.2-965s21c1
Sequence:CCGGGATGAGGTGACCTTACCTAATCTCGAGATTAGGTAAGGTCACCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027279.2-1166s21c1
Sequence:CCGGCTCACTTCAGAAACCATTTATCTCGAGATAAATGGTTTCTGAAGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027279
VALIDATED
METTL18 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 18
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027279.2-378s1c1
Sequence:CCGGCATCCCTCGATGATGGAACTTCTCGAGAAGTTCCATCATCGAGGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027279.2-533s1c1
Sequence:CCGGCCTATTGCTGACAGGTCAGATCTCGAGATCTGACCTGTCAGCAATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027279.2-817s1c1
Sequence:CCGGCCTCTTGACTTACTTCACAAACTCGAGTTTGTGAAGTAAGTCAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027279.2-1119s1c1
Sequence:CCGGGCAAGCTTGTATTACGTGAAACTCGAGTTTCACGTAATACAAGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027279.2-551s21c1
Sequence:CCGGGATGACCCAGAAGCTTGTAAACTCGAGTTTACAAGCTTCTGGGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027279.2-1214s21c1
Sequence:GTACCGGGAAACATTCCTCAGGCTATTACTCGAGTAATAGCCTGAGGAATGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027279.2-965s21c1
Sequence:CCGGGATGAGGTGACCTTACCTAATCTCGAGATTAGGTAAGGTCACCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027279.2-1166s21c1
Sequence:CCGGCTCACTTCAGAAACCATTTATCTCGAGATAAATGGTTTCTGAAGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033418
VALIDATED
METTL18 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 18
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033418.1-426s1c1
Sequence:CCGGGCAGAACAATTTGACTTGCCTCTCGAGAGGCAAGTCAAATTGTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033418.1-374s1c1
Sequence:CCGGGCTGTCAGTCTCAGAAAGTCACTCGAGTGACTTTCTGAGACTGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033418.1-793s1c1
Sequence:CCGGCCTTTGACCTCCTGGCTTATTCTCGAGAATAAGCCAGGAGGTCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033418.1-577s1c1
Sequence:CCGGCCAAAGAGCATGCTATGCCTACTCGAGTAGGCATAGCATGCTCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033418.1-447s1c1
Sequence:CCGGCAGGATCACTTGTGGGAACATCTCGAGATGTTCCCACAAGTGATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033418.1-582s1c1
Sequence:CCGGGAGCATGCTATGCCTAAAGATCTCGAGATCTTTAGGCATAGCATGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_033418.1-868s1c1
Sequence:CCGGGATCAGGTTTACTAGGTATAACTCGAGTTATACCTAGTAAACCTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033418.1-651s1c1
Sequence:CCGGCAGCATGTTAAGTTATCAGTACTCGAGTACTGATAACTTAACATGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033418.1-1158s1c1
Sequence:CCGGGAAACCATTTACAACCCAGATCTCGAGATCTGGGTTGTAAATGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033418.1-1151s1c1
Sequence:CCGGCACCTCAGAAACCATTTACAACTCGAGTTGTAAATGGTTTCTGAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033418.1-807s1c1
Sequence:CCGGGCTTATTTCACAAAGGCCAAACTCGAGTTTGGCCTTTGTGAAATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_033418.1-1053s21c1
Sequence:CCGGCAACTATATAAATGCCGATTTCTCGAGAAATCGGCATTTATATAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_033418.1-1163s21c1
Sequence:CCGGCATTTACAACCCAGATTATTACTCGAGTAATAATCTGGGTTGTAAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033418.1-948s21c1
Sequence:CCGGGATGAAGTAACCTTACCTAATCTCGAGATTAGGTAAGGTTACTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033418.1-449s21c1
Sequence:CCGGGGATCACTTGTGGGAACATAACTCGAGTTATGTTCCCACAAGTGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033418.1-868s21c1
Sequence:CCGGGATCAGGTTTACTAGGTATAACTCGAGTTATACCTAGTAAACCTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033418
VALIDATED
METTL18 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 18
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033418.1-426s1c1
Sequence:CCGGGCAGAACAATTTGACTTGCCTCTCGAGAGGCAAGTCAAATTGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033418.1-374s1c1
Sequence:CCGGGCTGTCAGTCTCAGAAAGTCACTCGAGTGACTTTCTGAGACTGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033418.1-793s1c1
Sequence:CCGGCCTTTGACCTCCTGGCTTATTCTCGAGAATAAGCCAGGAGGTCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033418.1-577s1c1
Sequence:CCGGCCAAAGAGCATGCTATGCCTACTCGAGTAGGCATAGCATGCTCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033418.1-447s1c1
Sequence:CCGGCAGGATCACTTGTGGGAACATCTCGAGATGTTCCCACAAGTGATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033418.1-582s1c1
Sequence:CCGGGAGCATGCTATGCCTAAAGATCTCGAGATCTTTAGGCATAGCATGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_033418.1-868s1c1
Sequence:CCGGGATCAGGTTTACTAGGTATAACTCGAGTTATACCTAGTAAACCTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033418.1-651s1c1
Sequence:CCGGCAGCATGTTAAGTTATCAGTACTCGAGTACTGATAACTTAACATGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033418.1-1158s1c1
Sequence:CCGGGAAACCATTTACAACCCAGATCTCGAGATCTGGGTTGTAAATGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033418.1-1151s1c1
Sequence:CCGGCACCTCAGAAACCATTTACAACTCGAGTTGTAAATGGTTTCTGAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033418.1-807s1c1
Sequence:CCGGGCTTATTTCACAAAGGCCAAACTCGAGTTTGGCCTTTGTGAAATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_033418.1-1053s21c1
Sequence:CCGGCAACTATATAAATGCCGATTTCTCGAGAAATCGGCATTTATATAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_033418.1-1163s21c1
Sequence:CCGGCATTTACAACCCAGATTATTACTCGAGTAATAATCTGGGTTGTAAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033418.1-948s21c1
Sequence:CCGGGATGAAGTAACCTTACCTAATCTCGAGATTAGGTAAGGTTACTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033418.1-449s21c1
Sequence:CCGGGGATCACTTGTGGGAACATAACTCGAGTTATGTTCCCACAAGTGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033418.1-868s21c1
Sequence:CCGGGATCAGGTTTACTAGGTATAACTCGAGTTATACCTAGTAAACCTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033418
VALIDATED
METTL18 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 18
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033418.1-426s1c1
Sequence:CCGGGCAGAACAATTTGACTTGCCTCTCGAGAGGCAAGTCAAATTGTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033418.1-374s1c1
Sequence:CCGGGCTGTCAGTCTCAGAAAGTCACTCGAGTGACTTTCTGAGACTGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033418.1-793s1c1
Sequence:CCGGCCTTTGACCTCCTGGCTTATTCTCGAGAATAAGCCAGGAGGTCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033418.1-577s1c1
Sequence:CCGGCCAAAGAGCATGCTATGCCTACTCGAGTAGGCATAGCATGCTCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033418.1-447s1c1
Sequence:CCGGCAGGATCACTTGTGGGAACATCTCGAGATGTTCCCACAAGTGATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033418.1-582s1c1
Sequence:CCGGGAGCATGCTATGCCTAAAGATCTCGAGATCTTTAGGCATAGCATGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_033418.1-868s1c1
Sequence:CCGGGATCAGGTTTACTAGGTATAACTCGAGTTATACCTAGTAAACCTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033418.1-651s1c1
Sequence:CCGGCAGCATGTTAAGTTATCAGTACTCGAGTACTGATAACTTAACATGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033418.1-1158s1c1
Sequence:CCGGGAAACCATTTACAACCCAGATCTCGAGATCTGGGTTGTAAATGGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033418.1-1151s1c1
Sequence:CCGGCACCTCAGAAACCATTTACAACTCGAGTTGTAAATGGTTTCTGAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033418.1-807s1c1
Sequence:CCGGGCTTATTTCACAAAGGCCAAACTCGAGTTTGGCCTTTGTGAAATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_033418.1-1053s21c1
Sequence:CCGGCAACTATATAAATGCCGATTTCTCGAGAAATCGGCATTTATATAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_033418.1-1163s21c1
Sequence:CCGGCATTTACAACCCAGATTATTACTCGAGTAATAATCTGGGTTGTAAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033418.1-948s21c1
Sequence:CCGGGATGAAGTAACCTTACCTAATCTCGAGATTAGGTAAGGTTACTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033418.1-449s21c1
Sequence:CCGGGGATCACTTGTGGGAACATAACTCGAGTTATGTTCCCACAAGTGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033418.1-868s21c1
Sequence:CCGGGATCAGGTTTACTAGGTATAACTCGAGTTATACCTAGTAAACCTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)