EMAIL THIS PAGE TO A FRIEND

METTL1

methyltransferase like 1

86 Gene Product Result for
Synonyms: C12orf1 TRM8 TRMT8 YDL201w
UniProtKB ID: Q9UBP6, B2RBX1, H7BXF2, Q14105, Q53FS9
Gene ID:
Human(4234) Summary: This gene is similar in sequence to the S. cerevisiae YDL201w gene. The gene product contains a conserved S-adenosylmethionine-binding motif and is inactivated by phosphorylation. Alternative splice variants encoding different protein isoforms have been described for this gene. A pseudogene has been identified on chromosome X. [provided by RefSeq, Jul 2008]
Mouse(17299) methyltransferase like 1
Rat(679091) methyltransferase like 1
Zebrafish(449779) methyltransferase like 1
dog(607590) methyltransferase like 1
cow(511197) methyltransferase like 1
domestic cat(101098391) methyltransferase like 1
domestic guinea pig(100714146) methyltransferase like 1
naked mole-rat(101699061) methyltransferase like 1
sheep(101115780) methyltransferase like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010792 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010792 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010792 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005371 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005371 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005371 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005371 Rosetta Predictions human pricing
NM_023033 Rosetta Predictions human pricing
XM_001054797 Rosetta Predictions rat pricing
NM_010792 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005371 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339470 predicted 970
2 SASI_Hs01_00119197 predicted 973
3 SASI_Hs02_00339471 predicted 1004
4 SASI_Hs01_00119199 predicted 771
5 SASI_Hs02_00339472 predicted 870
6 SASI_Hs01_00119200 predicted 1077
7 SASI_Hs02_00339473 predicted 1091
8 SASI_Hs02_00339474 predicted 782
9 SASI_Hs02_00339475 predicted 740
10 SASI_Hs02_00339476 predicted 1084
11 SASI_Hs01_00119196 predicted 544
12 SASI_Hs01_00119198 predicted 807
13 SASI_Hs01_00119201 predicted 903
14 SASI_Hs01_00119202 predicted 939
15 SASI_Hs01_00119203 predicted 877
16 SASI_Hs01_00119204 predicted 535
17 SASI_Hs01_00119205 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023033 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160082 predicted 778
2 SASI_Hs02_00356288 predicted 781
3 SASI_Hs01_00160083 predicted 822
4 SASI_Hs01_00160087 predicted 588
5 SASI_Hs01_00160088 predicted 677
6 SASI_Hs01_00160089 predicted 896
7 SASI_Hs02_00356289 predicted 897
8 SASI_Hs02_00356290 predicted 598
9 SASI_Hs02_00356291 predicted 551
10 SASI_Hs02_00356292 predicted 893
11 SASI_Hs01_00160084 predicted 278
12 SASI_Hs01_00160085 predicted 485
13 SASI_Hs01_00160086 predicted 355
14 SASI_Hs01_00160090 predicted 376
15 SASI_Hs01_00160091 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054797 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277296 predicted 456
2 SASI_Rn02_00277297 predicted 446
3 SASI_Rn02_00277298 predicted 685
4 SASI_Rn02_00277299 predicted 207
5 SASI_Rn02_00277300 predicted 772
6 SASI_Rn02_00277301 predicted 308
7 SASI_Rn02_00277302 predicted 359
8 SASI_Rn02_00277303 predicted 512
9 SASI_Rn02_00277304 predicted 212
10 SASI_Rn02_00277305 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010792 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319363 predicted 325
2 SASI_Mm01_00169452 predicted 633
3 SASI_Mm01_00169453 predicted 348
4 SASI_Mm01_00169454 predicted 517
5 SASI_Mm01_00169455 predicted 460
6 SASI_Mm01_00169456 predicted 522
7 SASI_Mm01_00169458 predicted 648
8 SASI_Mm01_00169459 predicted 368
9 SASI_Mm01_00169460 predicted 486
10 SASI_Mm01_00169461 predicted 248
11 SASI_Mm01_00169457 predicted 445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010792
VALIDATED
METTL1 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010792.1-449s21c1
Sequence:CCGGCGCCATGAAACACCTTCCTAACTCGAGTTAGGAAGGTGTTTCATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010792.1-181s21c1
Sequence:CCGGCAGAGTTCTTTGCTCCGCTTACTCGAGTAAGCGGAGCAAAGAACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010792.1-518s21c1
Sequence:CCGGCCCACACTTTAAGCGAACGAACTCGAGTTCGTTCGCTTAAAGTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010792.1-562s21c1
Sequence:CCGGCTACGCTTCTGGCAGAGTATGCTCGAGCATACTCTGCCAGAAGCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010792.1-220s21c1
Sequence:CCGGATGATCCAAAGGATGAGAAAGCTCGAGCTTTCTCATCCTTTGGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010792.1-449s1c1
Sequence:CCGGCGCCATGAAACACCTTCCTAACTCGAGTTAGGAAGGTGTTTCATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010792.1-180s1c1
Sequence:CCGGCCAGAGTTCTTTGCTCCGCTTCTCGAGAAGCGGAGCAAAGAACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010792.1-518s1c1
Sequence:CCGGCCCACACTTTAAGCGAACGAACTCGAGTTCGTTCGCTTAAAGTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010792.1-181s1c1
Sequence:CCGGCAGAGTTCTTTGCTCCGCTTACTCGAGTAAGCGGAGCAAAGAACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010792.1-450s1c1
Sequence:CCGGGCCATGAAACACCTTCCTAATCTCGAGATTAGGAAGGTGTTTCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010792
VALIDATED
METTL1 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010792.1-449s21c1
Sequence:CCGGCGCCATGAAACACCTTCCTAACTCGAGTTAGGAAGGTGTTTCATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010792.1-181s21c1
Sequence:CCGGCAGAGTTCTTTGCTCCGCTTACTCGAGTAAGCGGAGCAAAGAACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010792.1-518s21c1
Sequence:CCGGCCCACACTTTAAGCGAACGAACTCGAGTTCGTTCGCTTAAAGTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010792.1-562s21c1
Sequence:CCGGCTACGCTTCTGGCAGAGTATGCTCGAGCATACTCTGCCAGAAGCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010792.1-220s21c1
Sequence:CCGGATGATCCAAAGGATGAGAAAGCTCGAGCTTTCTCATCCTTTGGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010792.1-449s1c1
Sequence:CCGGCGCCATGAAACACCTTCCTAACTCGAGTTAGGAAGGTGTTTCATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010792.1-180s1c1
Sequence:CCGGCCAGAGTTCTTTGCTCCGCTTCTCGAGAAGCGGAGCAAAGAACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010792.1-518s1c1
Sequence:CCGGCCCACACTTTAAGCGAACGAACTCGAGTTCGTTCGCTTAAAGTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010792.1-181s1c1
Sequence:CCGGCAGAGTTCTTTGCTCCGCTTACTCGAGTAAGCGGAGCAAAGAACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010792.1-450s1c1
Sequence:CCGGGCCATGAAACACCTTCCTAATCTCGAGATTAGGAAGGTGTTTCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010792
VALIDATED
METTL1 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010792.1-449s21c1
Sequence:CCGGCGCCATGAAACACCTTCCTAACTCGAGTTAGGAAGGTGTTTCATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010792.1-181s21c1
Sequence:CCGGCAGAGTTCTTTGCTCCGCTTACTCGAGTAAGCGGAGCAAAGAACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010792.1-518s21c1
Sequence:CCGGCCCACACTTTAAGCGAACGAACTCGAGTTCGTTCGCTTAAAGTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010792.1-562s21c1
Sequence:CCGGCTACGCTTCTGGCAGAGTATGCTCGAGCATACTCTGCCAGAAGCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010792.1-220s21c1
Sequence:CCGGATGATCCAAAGGATGAGAAAGCTCGAGCTTTCTCATCCTTTGGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010792.1-449s1c1
Sequence:CCGGCGCCATGAAACACCTTCCTAACTCGAGTTAGGAAGGTGTTTCATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010792.1-180s1c1
Sequence:CCGGCCAGAGTTCTTTGCTCCGCTTCTCGAGAAGCGGAGCAAAGAACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010792.1-518s1c1
Sequence:CCGGCCCACACTTTAAGCGAACGAACTCGAGTTCGTTCGCTTAAAGTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010792.1-181s1c1
Sequence:CCGGCAGAGTTCTTTGCTCCGCTTACTCGAGTAAGCGGAGCAAAGAACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010792.1-450s1c1
Sequence:CCGGGCCATGAAACACCTTCCTAATCTCGAGATTAGGAAGGTGTTTCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005371
VALIDATED
METTL1 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005371.5-660s21c1
Sequence:CCGGCGACTGGATGTGCACTCATTTCTCGAGAAATGAGTGCACATCCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304125    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_005371.5-970s21c1
Sequence:CCGGTGAGACACAGTACTCTCTTAACTCGAGTTAAGAGAGTACTGTGTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005371.5-627s21c1
Sequence:CCGGGGTGTATACCATAACCGATGTCTCGAGACATCGGTTATGGTATACACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005371.5-593s21c1
Sequence:CCGGCAGAATATGCCTACGTGCTAACTCGAGTTAGCACGTAGGCATATTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005371.5-537s21c1
Sequence:CCGGCCCACATTTCAAGCGGACAAACTCGAGTTTGTCCGCTTGAAATGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005371.3-878s1c1
Sequence:CCGGCCCACATTTCAAGCGGACAAACTCGAGTTTGTCCGCTTGAAATGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005371.3-821s1c1
Sequence:CCGGCCTTCCTAACTTCTTCTACAACTCGAGTTGTAGAAGAAGTTAGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005371.3-714s1c1
Sequence:CCGGCGGGTGAAGGTCTCAGACTATCTCGAGATAGTCTGAGACCTTCACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005371.3-579s1c1
Sequence:CCGGGATGACCCAAAGGATAAGAAACTCGAGTTTCTTATCCTTTGGGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005371.3-1001s1c1
Sequence:CCGGCGACTGGATGTGCACTCATTTCTCGAGAAATGAGTGCACATCCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005371
VALIDATED
METTL1 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005371.5-660s21c1
Sequence:CCGGCGACTGGATGTGCACTCATTTCTCGAGAAATGAGTGCACATCCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304125    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_005371.5-970s21c1
Sequence:CCGGTGAGACACAGTACTCTCTTAACTCGAGTTAAGAGAGTACTGTGTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005371.5-627s21c1
Sequence:CCGGGGTGTATACCATAACCGATGTCTCGAGACATCGGTTATGGTATACACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005371.5-593s21c1
Sequence:CCGGCAGAATATGCCTACGTGCTAACTCGAGTTAGCACGTAGGCATATTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005371.5-537s21c1
Sequence:CCGGCCCACATTTCAAGCGGACAAACTCGAGTTTGTCCGCTTGAAATGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005371.3-878s1c1
Sequence:CCGGCCCACATTTCAAGCGGACAAACTCGAGTTTGTCCGCTTGAAATGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005371.3-821s1c1
Sequence:CCGGCCTTCCTAACTTCTTCTACAACTCGAGTTGTAGAAGAAGTTAGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005371.3-714s1c1
Sequence:CCGGCGGGTGAAGGTCTCAGACTATCTCGAGATAGTCTGAGACCTTCACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005371.3-579s1c1
Sequence:CCGGGATGACCCAAAGGATAAGAAACTCGAGTTTCTTATCCTTTGGGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005371.3-1001s1c1
Sequence:CCGGCGACTGGATGTGCACTCATTTCTCGAGAAATGAGTGCACATCCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005371
VALIDATED
METTL1 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005371.5-660s21c1
Sequence:CCGGCGACTGGATGTGCACTCATTTCTCGAGAAATGAGTGCACATCCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304125    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_005371.5-970s21c1
Sequence:CCGGTGAGACACAGTACTCTCTTAACTCGAGTTAAGAGAGTACTGTGTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005371.5-627s21c1
Sequence:CCGGGGTGTATACCATAACCGATGTCTCGAGACATCGGTTATGGTATACACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005371.5-593s21c1
Sequence:CCGGCAGAATATGCCTACGTGCTAACTCGAGTTAGCACGTAGGCATATTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005371.5-537s21c1
Sequence:CCGGCCCACATTTCAAGCGGACAAACTCGAGTTTGTCCGCTTGAAATGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005371.3-878s1c1
Sequence:CCGGCCCACATTTCAAGCGGACAAACTCGAGTTTGTCCGCTTGAAATGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005371.3-821s1c1
Sequence:CCGGCCTTCCTAACTTCTTCTACAACTCGAGTTGTAGAAGAAGTTAGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005371.3-714s1c1
Sequence:CCGGCGGGTGAAGGTCTCAGACTATCTCGAGATAGTCTGAGACCTTCACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005371.3-579s1c1
Sequence:CCGGGATGACCCAAAGGATAAGAAACTCGAGTTTCTTATCCTTTGGGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005371.3-1001s1c1
Sequence:CCGGCGACTGGATGTGCACTCATTTCTCGAGAAATGAGTGCACATCCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)