EMAIL THIS PAGE TO A FRIEND

METTL20

methyltransferase like 20

61 Gene Product Result for
Synonyms: C12orf72
UniProtKB ID: Q8IXQ9, D3DUW3
Gene ID:
Mouse(320204) methyltransferase like 20
Rat(316976) methyltransferase like 20
sheep(101107011) methyltransferase like 20
Zebrafish(100005455) methyltransferase like 20
cow(530461) methyltransferase like 20
domestic cat(101093445) methyltransferase like 20
dog(486619) methyltransferase like 20
chicken(418138) methyltransferase like 20
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177101 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177101 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177101 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173802 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173802 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173802 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173802 Rosetta Predictions human pricing
NM_198772 Rosetta Predictions rat pricing
NM_177101 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052708 predicted 672
2 SASI_Hs01_00052709 predicted 548
3 SASI_Hs01_00052710 predicted 724
4 SASI_Hs01_00052711 predicted 740
5 SASI_Hs01_00052712 predicted 697
6 SASI_Hs01_00052713 predicted 749
7 SASI_Hs01_00052714 predicted 453
8 SASI_Hs01_00052715 predicted 555
9 SASI_Hs01_00052716 predicted 699
10 SASI_Hs01_00052717 predicted 709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198772 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091339 predicted 1193
2 SASI_Rn01_00091340 predicted 653
3 SASI_Rn01_00091341 predicted 1198
4 SASI_Rn01_00091342 predicted 1173
5 SASI_Rn02_00270020 predicted 1153
6 SASI_Rn01_00091343 predicted 1017
7 SASI_Rn01_00091344 predicted 796
8 SASI_Rn01_00091345 predicted 455
9 SASI_Rn01_00091346 predicted 1087
10 SASI_Rn01_00091347 predicted 1203
11 SASI_Rn01_00091348 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177101 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122133 predicted 1056
2 SASI_Mm01_00122134 predicted 517
3 SASI_Mm01_00122135 predicted 1013
4 SASI_Mm01_00122136 predicted 595
5 SASI_Mm01_00122137 predicted 394
6 SASI_Mm01_00122138 predicted 1051
7 SASI_Mm01_00122139 predicted 864
8 SASI_Mm01_00122140 predicted 610
9 SASI_Mm01_00122141 predicted 549
10 SASI_Mm02_00347095 predicted 266
11 SASI_Mm01_00122132 predicted 903
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177101
VALIDATED
METTL20 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 20
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177101.3-1280s1c1
Sequence:CCGGCCTTGAATAACTGTATGGTTTCTCGAGAAACCATACAGTTATTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177101.3-891s1c1
Sequence:CCGGCGGCATCAACTGTACCAACTACTCGAGTAGTTGGTACAGTTGATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177101.3-735s1c1
Sequence:CCGGCAAGGTAAGTTTGATCTCATTCTCGAGAATGAGATCAAACTTACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177101.3-533s1c1
Sequence:CCGGCCCTGCTGTTGTTAGAGGAAACTCGAGTTTCCTCTAACAACAGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177101.3-655s1c1
Sequence:CCGGGAATGGCGATTACACTAAATTCTCGAGAATTTAGTGTAATCGCCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177101.4-655s21c1
Sequence:CCGGGAATGGCGATTACACTAAATTCTCGAGAATTTAGTGTAATCGCCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177101.4-470s21c1
Sequence:CCGGTGATCCCTACTGGGCTATTTACTCGAGTAAATAGCCCAGTAGGGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177101.4-1048s21c1
Sequence:CCGGATATCCTCTGTAGGAGGTATTCTCGAGAATACCTCCTACAGAGGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177101.4-735s21c1
Sequence:CCGGCAAGGTAAGTTTGATCTCATTCTCGAGAATGAGATCAAACTTACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177101.4-622s21c1
Sequence:CCGGAGATCTTGGCCAACGACATAGCTCGAGCTATGTCGTTGGCCAAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177101
VALIDATED
METTL20 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 20
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177101.3-1280s1c1
Sequence:CCGGCCTTGAATAACTGTATGGTTTCTCGAGAAACCATACAGTTATTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177101.3-891s1c1
Sequence:CCGGCGGCATCAACTGTACCAACTACTCGAGTAGTTGGTACAGTTGATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177101.3-735s1c1
Sequence:CCGGCAAGGTAAGTTTGATCTCATTCTCGAGAATGAGATCAAACTTACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177101.3-533s1c1
Sequence:CCGGCCCTGCTGTTGTTAGAGGAAACTCGAGTTTCCTCTAACAACAGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177101.3-655s1c1
Sequence:CCGGGAATGGCGATTACACTAAATTCTCGAGAATTTAGTGTAATCGCCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177101.4-655s21c1
Sequence:CCGGGAATGGCGATTACACTAAATTCTCGAGAATTTAGTGTAATCGCCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177101.4-470s21c1
Sequence:CCGGTGATCCCTACTGGGCTATTTACTCGAGTAAATAGCCCAGTAGGGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177101.4-1048s21c1
Sequence:CCGGATATCCTCTGTAGGAGGTATTCTCGAGAATACCTCCTACAGAGGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177101.4-735s21c1
Sequence:CCGGCAAGGTAAGTTTGATCTCATTCTCGAGAATGAGATCAAACTTACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177101.4-622s21c1
Sequence:CCGGAGATCTTGGCCAACGACATAGCTCGAGCTATGTCGTTGGCCAAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177101
VALIDATED
METTL20 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 20
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177101.3-1280s1c1
Sequence:CCGGCCTTGAATAACTGTATGGTTTCTCGAGAAACCATACAGTTATTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177101.3-891s1c1
Sequence:CCGGCGGCATCAACTGTACCAACTACTCGAGTAGTTGGTACAGTTGATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177101.3-735s1c1
Sequence:CCGGCAAGGTAAGTTTGATCTCATTCTCGAGAATGAGATCAAACTTACCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177101.3-533s1c1
Sequence:CCGGCCCTGCTGTTGTTAGAGGAAACTCGAGTTTCCTCTAACAACAGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177101.3-655s1c1
Sequence:CCGGGAATGGCGATTACACTAAATTCTCGAGAATTTAGTGTAATCGCCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177101.4-655s21c1
Sequence:CCGGGAATGGCGATTACACTAAATTCTCGAGAATTTAGTGTAATCGCCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177101.4-470s21c1
Sequence:CCGGTGATCCCTACTGGGCTATTTACTCGAGTAAATAGCCCAGTAGGGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177101.4-1048s21c1
Sequence:CCGGATATCCTCTGTAGGAGGTATTCTCGAGAATACCTCCTACAGAGGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177101.4-735s21c1
Sequence:CCGGCAAGGTAAGTTTGATCTCATTCTCGAGAATGAGATCAAACTTACCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177101.4-622s21c1
Sequence:CCGGAGATCTTGGCCAACGACATAGCTCGAGCTATGTCGTTGGCCAAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173802
METTL20 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 20
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173802.2-871s1c1
Sequence:CCGGCCTTGCAGATAGTCTTCATCACTCGAGTGATGAAGACTATCTGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173802.2-821s1c1
Sequence:CCGGCAAGATAAGTGGGACCTTGTTCTCGAGAACAAGGTCCCACTTATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173802.2-818s1c1
Sequence:CCGGGAACAAGATAAGTGGGACCTTCTCGAGAAGGTCCCACTTATCTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162199    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173802.2-1311s1c1
Sequence:CCGGCCGCTGAAGGAATATGATTATCTCGAGATAATCATATTCCTTCAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173802.2-985s1c1
Sequence:CCGGCCTGCACAAAGTGGTAGAATACTCGAGTATTCTACCACTTTGTGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173802.3-716s21c1
Sequence:CCGGGCCAATGACATAGACCCTATTCTCGAGAATAGGGTCTATGTCATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173802.3-739s21c1
Sequence:CCGGAGGAATGGCTATTACACTAAACTCGAGTTTAGTGTAATAGCCATTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173802.3-1147s21c1
Sequence:CCGGGAGATACTCTCCAGTTTAATGCTCGAGCATTAAACTGGAGAGTATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173802
METTL20 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 20
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173802.2-871s1c1
Sequence:CCGGCCTTGCAGATAGTCTTCATCACTCGAGTGATGAAGACTATCTGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173802.2-821s1c1
Sequence:CCGGCAAGATAAGTGGGACCTTGTTCTCGAGAACAAGGTCCCACTTATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173802.2-818s1c1
Sequence:CCGGGAACAAGATAAGTGGGACCTTCTCGAGAAGGTCCCACTTATCTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162199    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173802.2-1311s1c1
Sequence:CCGGCCGCTGAAGGAATATGATTATCTCGAGATAATCATATTCCTTCAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173802.2-985s1c1
Sequence:CCGGCCTGCACAAAGTGGTAGAATACTCGAGTATTCTACCACTTTGTGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173802.3-716s21c1
Sequence:CCGGGCCAATGACATAGACCCTATTCTCGAGAATAGGGTCTATGTCATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173802.3-739s21c1
Sequence:CCGGAGGAATGGCTATTACACTAAACTCGAGTTTAGTGTAATAGCCATTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173802.3-1147s21c1
Sequence:CCGGGAGATACTCTCCAGTTTAATGCTCGAGCATTAAACTGGAGAGTATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173802
METTL20 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 20
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173802.2-871s1c1
Sequence:CCGGCCTTGCAGATAGTCTTCATCACTCGAGTGATGAAGACTATCTGCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173802.2-821s1c1
Sequence:CCGGCAAGATAAGTGGGACCTTGTTCTCGAGAACAAGGTCCCACTTATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173802.2-818s1c1
Sequence:CCGGGAACAAGATAAGTGGGACCTTCTCGAGAAGGTCCCACTTATCTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162199    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173802.2-1311s1c1
Sequence:CCGGCCGCTGAAGGAATATGATTATCTCGAGATAATCATATTCCTTCAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173802.2-985s1c1
Sequence:CCGGCCTGCACAAAGTGGTAGAATACTCGAGTATTCTACCACTTTGTGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173802.3-716s21c1
Sequence:CCGGGCCAATGACATAGACCCTATTCTCGAGAATAGGGTCTATGTCATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173802.3-739s21c1
Sequence:CCGGAGGAATGGCTATTACACTAAACTCGAGTTTAGTGTAATAGCCATTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173802.3-1147s21c1
Sequence:CCGGGAGATACTCTCCAGTTTAATGCTCGAGCATTAAACTGGAGAGTATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)