EMAIL THIS PAGE TO A FRIEND

METTL21A

methyltransferase like 21A

64 Gene Product Result for
Synonyms: FAM119A HCA557b
UniProtKB ID: Q8WXB1, Q53RV0, Q8N1Z9, Q96GH6
Gene ID:
Mouse(67099) methyltransferase like 21A
Rat(301466) methyltransferase like 21A
Zebrafish(541441) methyltransferase like 21A
cow(615773) methyltransferase like 21A
domestic cat(101091720) methyltransferase like 21A
dog(607933) methyltransferase like 21A
chicken(424094) methyltransferase like 21A
domestic guinea pig(100727792) methyltransferase like 21A
sheep(101118081) methyltransferase like 21A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025964 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025964 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025964 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145280 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145280 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145280 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127395 Rosetta Predictions human pricing
NM_145280 Rosetta Predictions human pricing
XM_001071910 Rosetta Predictions rat pricing
XM_237209 Rosetta Predictions rat pricing
NM_025964 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329424 predicted 929
2 SASI_Hs02_00329425 predicted 739
3 SASI_Hs02_00329426 predicted 754
4 SASI_Hs02_00329427 predicted 871
5 SASI_Hs02_00329428 predicted 475
6 SASI_Hs02_00329429 predicted 624
7 SASI_Hs02_00329430 predicted 664
8 SASI_Hs02_00329431 predicted 640
9 SASI_Hs02_00329432 predicted 920
10 SASI_Hs02_00329433 predicted 896
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365156 predicted 868
2 SASI_Hs01_00047371 predicted 682
3 SASI_Hs01_00047372 predicted 690
4 SASI_Hs01_00047373 predicted 810
5 SASI_Hs01_00047374 predicted 423
6 SASI_Hs02_00365157 predicted 564
7 SASI_Hs02_00365158 predicted 615
8 SASI_Hs02_00365159 predicted 585
9 SASI_Hs01_00047376 predicted 862
10 SASI_Hs01_00047377 predicted 840
11 SASI_Hs01_00047370 predicted 630
12 SASI_Hs01_00047375 predicted 624
13 SASI_Hs01_00047378 predicted 871
14 SASI_Hs01_00047379 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071910 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00336964 predicted 284
2 SASI_Rn02_00336965 predicted 730
3 SASI_Rn02_00336966 predicted 716
4 SASI_Rn02_00336967 predicted 741
5 SASI_Rn02_00336968 predicted 559
6 SASI_Rn02_00336969 predicted 786
7 SASI_Rn02_00336970 predicted 445
8 SASI_Rn02_00336971 predicted 662
9 SASI_Rn02_00336972 predicted 708
10 SASI_Rn02_00336973 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237209 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390717 predicted 281
2 SASI_Rn02_00390718 predicted 731
3 SASI_Rn02_00390719 predicted 712
4 SASI_Rn02_00390720 predicted 738
5 SASI_Rn02_00390721 predicted 556
6 SASI_Rn02_00390722 predicted 792
7 SASI_Rn02_00390723 predicted 449
8 SASI_Rn02_00390724 predicted 668
9 SASI_Rn02_00390725 predicted 707
10 SASI_Rn02_00390726 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025964 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137004 predicted 786
2 SASI_Mm01_00137005 predicted 1232
3 SASI_Mm01_00137006 predicted 1008
4 SASI_Mm01_00137007 predicted 1465
5 SASI_Mm01_00137008 predicted 1399
6 SASI_Mm01_00137009 predicted 1443
7 SASI_Mm01_00137010 predicted 1497
8 SASI_Mm01_00137011 predicted 778
9 SASI_Mm01_00137012 predicted 1452
10 SASI_Mm01_00137013 predicted 1456
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025964
METTL21A MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 21A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025964.3-1275s21c1
Sequence:CCGGCGCTATGAACGGGATAGTAACCTCGAGGTTACTATCCCGTTCATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025964.3-1397s21c1
Sequence:CCGGGGACTTGTAGCGGGCAGTATTCTCGAGAATACTGCCCGCTACAAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025964.3-1026s21c1
Sequence:CCGGACGGATCGGAAAGTAGCATTACTCGAGTAATGCTACTTTCCGATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025964.3-2233s21c1
Sequence:CCGGAGTCTGTATTGTACCTATAATCTCGAGATTATAGGTACAATACAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025964.3-1168s21c1
Sequence:CCGGTACTTGGAGCTGATGTCATATCTCGAGATATGACATCAGCTCCAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025964
METTL21A MISSION shRNA shRNA Plasmid DNA
methyltransferase like 21A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025964.3-1275s21c1
Sequence:CCGGCGCTATGAACGGGATAGTAACCTCGAGGTTACTATCCCGTTCATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025964.3-1397s21c1
Sequence:CCGGGGACTTGTAGCGGGCAGTATTCTCGAGAATACTGCCCGCTACAAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025964.3-1026s21c1
Sequence:CCGGACGGATCGGAAAGTAGCATTACTCGAGTAATGCTACTTTCCGATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025964.3-2233s21c1
Sequence:CCGGAGTCTGTATTGTACCTATAATCTCGAGATTATAGGTACAATACAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025964.3-1168s21c1
Sequence:CCGGTACTTGGAGCTGATGTCATATCTCGAGATATGACATCAGCTCCAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025964
METTL21A MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 21A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025964.3-1275s21c1
Sequence:CCGGCGCTATGAACGGGATAGTAACCTCGAGGTTACTATCCCGTTCATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025964.3-1397s21c1
Sequence:CCGGGGACTTGTAGCGGGCAGTATTCTCGAGAATACTGCCCGCTACAAGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025964.3-1026s21c1
Sequence:CCGGACGGATCGGAAAGTAGCATTACTCGAGTAATGCTACTTTCCGATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025964.3-2233s21c1
Sequence:CCGGAGTCTGTATTGTACCTATAATCTCGAGATTATAGGTACAATACAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025964.3-1168s21c1
Sequence:CCGGTACTTGGAGCTGATGTCATATCTCGAGATATGACATCAGCTCCAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145280
VALIDATED
METTL21A MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 21A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_145280.4-471s21c1
Sequence:CCGGCAAACGTTCAAGCCAACTTACCTCGAGGTAAGTTGGCTTGAACGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145280.4-806s21c1
Sequence:CCGGGAGGACTTATAATTGGCTATACTCGAGTATAGCCAATTATAAGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145280.4-683s21c1
Sequence:CCGGATTCGCTATGAACGGGATAACCTCGAGGTTATCCCGTTCATAGCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_145280.4-581s21c1
Sequence:CCGGCTTGGTGCTGATATCATATATCTCGAGATATATGATATCAGCACCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145280.4-1376s21c1
Sequence:CCGGGCCTTAATTTCAGGTATATATCTCGAGATATATACCTGAAATTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145280.3-735s1c1
Sequence:CCGGGAGGCAATTTATTGTGAGAAACTCGAGTTTCTCACAATAAATTGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145280.3-616s1c1
Sequence:CCGGGAAGAAACATTCACAGATCTTCTCGAGAAGATCTGTGAATGTTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145280
VALIDATED
METTL21A MISSION shRNA shRNA Plasmid DNA
methyltransferase like 21A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_145280.4-471s21c1
Sequence:CCGGCAAACGTTCAAGCCAACTTACCTCGAGGTAAGTTGGCTTGAACGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145280.4-806s21c1
Sequence:CCGGGAGGACTTATAATTGGCTATACTCGAGTATAGCCAATTATAAGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145280.4-683s21c1
Sequence:CCGGATTCGCTATGAACGGGATAACCTCGAGGTTATCCCGTTCATAGCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_145280.4-581s21c1
Sequence:CCGGCTTGGTGCTGATATCATATATCTCGAGATATATGATATCAGCACCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145280.4-1376s21c1
Sequence:CCGGGCCTTAATTTCAGGTATATATCTCGAGATATATACCTGAAATTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145280.3-735s1c1
Sequence:CCGGGAGGCAATTTATTGTGAGAAACTCGAGTTTCTCACAATAAATTGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145280.3-616s1c1
Sequence:CCGGGAAGAAACATTCACAGATCTTCTCGAGAAGATCTGTGAATGTTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145280
VALIDATED
METTL21A MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 21A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_145280.4-471s21c1
Sequence:CCGGCAAACGTTCAAGCCAACTTACCTCGAGGTAAGTTGGCTTGAACGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145280.4-806s21c1
Sequence:CCGGGAGGACTTATAATTGGCTATACTCGAGTATAGCCAATTATAAGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145280.4-683s21c1
Sequence:CCGGATTCGCTATGAACGGGATAACCTCGAGGTTATCCCGTTCATAGCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_145280.4-581s21c1
Sequence:CCGGCTTGGTGCTGATATCATATATCTCGAGATATATGATATCAGCACCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145280.4-1376s21c1
Sequence:CCGGGCCTTAATTTCAGGTATATATCTCGAGATATATACCTGAAATTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145280.3-735s1c1
Sequence:CCGGGAGGCAATTTATTGTGAGAAACTCGAGTTTCTCACAATAAATTGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145280.3-616s1c1
Sequence:CCGGGAAGAAACATTCACAGATCTTCTCGAGAAGATCTGTGAATGTTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)