EMAIL THIS PAGE TO A FRIEND

METTL21B

methyltransferase like 21B

68 Gene Product Result for
Synonyms: FAM119B
UniProtKB ID: Q96AZ1, Q9H749, Q9Y3W2
Gene ID:
cow(100125307) methyltransferase like 21B
domestic cat(101098642) methyltransferase like 21B
dog(100688454) methyltransferase like 21B
sheep(101115529) methyltransferase like 21B
domestic guinea pig(100717122) methyltransferase like 21B
naked mole-rat(101699642) methyltransferase like 21B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015433 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015433 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015433 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU089241 MISSION® esiRNA esiRNA human FAM119B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015433 Rosetta Predictions human pricing
NM_206914 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073311 predicted 837
2 SASI_Hs01_00073312 predicted 905
3 SASI_Hs01_00073313 predicted 876
4 SASI_Hs01_00073314 predicted 875
5 SASI_Hs02_00347820 predicted 817
6 SASI_Hs01_00073315 predicted 1097
7 SASI_Hs01_00073317 predicted 1063
8 SASI_Hs01_00073318 predicted 1055
9 SASI_Hs01_00073319 predicted 351
10 SASI_Hs01_00073320 predicted 639
11 SASI_Hs01_00073316 predicted 531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035245 predicted 977
2 SASI_Hs01_00035246 predicted 1041
3 SASI_Hs01_00035247 predicted 1013
4 SASI_Hs01_00035248 predicted 1017
5 SASI_Hs02_00373602 predicted 951
6 SASI_Hs01_00035249 predicted 670
7 SASI_Hs01_00035250 predicted 497
8 SASI_Hs01_00035251 predicted 350
9 SASI_Hs01_00035252 predicted 781
10 SASI_Hs02_00373603 predicted 309
11 SASI_Hs01_00035253 predicted 1006
12 SASI_Hs01_00035254 predicted 673
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015433
VALIDATED
METTL21B MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 21B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_015433.2-219s1c1
Sequence:CCGGCAGTTCTGTTTCTGTGGGCATCTCGAGATGCCCACAGAAACAGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140524    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_015433.2-881s1c1
Sequence:CCGGGCCACAAACATGAGGACCAAACTCGAGTTTGGTCCTCATGTTTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015433.2-662s1c1
Sequence:CCGGCTCCAAGATGAGAAAGGAGCACTCGAGTGCTCCTTTCTCATCTTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_015433.2-196s1c1
Sequence:CCGGCAGACTCTTACTCGGAGAAGACTCGAGTCTTCTCCGAGTAAGAGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_015433.2-2453s1c1
Sequence:CCGGGCTGTGGTTTACTCCTGTCTACTCGAGTAGACAGGAGTAAACCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015433.2-348s1c1
Sequence:CCGGCGAGGCAAGAAGGTGATCGAACTCGAGTTCGATCACCTTCTTGCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015433.2-191s1c1
Sequence:CCGGCTTTGCAGACTCTTACTCGGACTCGAGTCCGAGTAAGAGTCTGCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015433
VALIDATED
METTL21B MISSION shRNA shRNA Plasmid DNA
methyltransferase like 21B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_015433.2-219s1c1
Sequence:CCGGCAGTTCTGTTTCTGTGGGCATCTCGAGATGCCCACAGAAACAGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140524    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_015433.2-881s1c1
Sequence:CCGGGCCACAAACATGAGGACCAAACTCGAGTTTGGTCCTCATGTTTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015433.2-662s1c1
Sequence:CCGGCTCCAAGATGAGAAAGGAGCACTCGAGTGCTCCTTTCTCATCTTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_015433.2-196s1c1
Sequence:CCGGCAGACTCTTACTCGGAGAAGACTCGAGTCTTCTCCGAGTAAGAGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_015433.2-2453s1c1
Sequence:CCGGGCTGTGGTTTACTCCTGTCTACTCGAGTAGACAGGAGTAAACCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015433.2-348s1c1
Sequence:CCGGCGAGGCAAGAAGGTGATCGAACTCGAGTTCGATCACCTTCTTGCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015433.2-191s1c1
Sequence:CCGGCTTTGCAGACTCTTACTCGGACTCGAGTCCGAGTAAGAGTCTGCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015433
VALIDATED
METTL21B MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 21B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_015433.2-219s1c1
Sequence:CCGGCAGTTCTGTTTCTGTGGGCATCTCGAGATGCCCACAGAAACAGAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140524    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_015433.2-881s1c1
Sequence:CCGGGCCACAAACATGAGGACCAAACTCGAGTTTGGTCCTCATGTTTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015433.2-662s1c1
Sequence:CCGGCTCCAAGATGAGAAAGGAGCACTCGAGTGCTCCTTTCTCATCTTGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_015433.2-196s1c1
Sequence:CCGGCAGACTCTTACTCGGAGAAGACTCGAGTCTTCTCCGAGTAAGAGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_015433.2-2453s1c1
Sequence:CCGGGCTGTGGTTTACTCCTGTCTACTCGAGTAGACAGGAGTAAACCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015433.2-348s1c1
Sequence:CCGGCGAGGCAAGAAGGTGATCGAACTCGAGTTCGATCACCTTCTTGCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015433.2-191s1c1
Sequence:CCGGCTTTGCAGACTCTTACTCGGACTCGAGTCCGAGTAAGAGTCTGCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)