EMAIL THIS PAGE TO A FRIEND

METTL21C

methyltransferase like 21C

45 Gene Product Result for
Synonyms: C13orf39
UniProtKB ID: Q5VZV1
Gene ID:
Mouse(433294) methyltransferase like 21C
Rat(301378) methyltransferase like 21C
naked mole-rat(101699987) methyltransferase like 21C
domestic guinea pig(100720559) methyltransferase like 21C
sheep(101113506) methyltransferase like 21C
chicken(418768) methyltransferase like 21C
domestic cat(101084928) methyltransferase like 21C
dog(485538) methyltransferase like 21C
cow(519447) methyltransferase like 21C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010977 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010977 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010977 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013799 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013799 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013799 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010977 Rosetta Predictions human pricing
NM_001106908 Rosetta Predictions rat pricing
NM_001013799 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245302 predicted 577
2 SASI_Hs01_00245303 predicted 283
3 SASI_Hs01_00245304 predicted 440
4 SASI_Hs01_00245305 predicted 206
5 SASI_Hs01_00245306 predicted 321
6 SASI_Hs01_00245307 predicted 489
7 SASI_Hs01_00245308 predicted 739
8 SASI_Hs01_00245309 predicted 313
9 SASI_Hs01_00245310 predicted 236
10 SASI_Hs01_00245311 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106908 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223586 predicted 344
2 SASI_Rn02_00223587 predicted 867
3 SASI_Rn02_00223588 predicted 727
4 SASI_Rn02_00223589 predicted 498
5 SASI_Rn02_00223590 predicted 587
6 SASI_Rn02_00223591 predicted 217
7 SASI_Rn02_00223592 predicted 723
8 SASI_Rn02_00223593 predicted 721
9 SASI_Rn02_00223594 predicted 282
10 SASI_Rn02_00223595 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013799 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123955 predicted 834
2 SASI_Mm01_00123956 predicted 489
3 SASI_Mm01_00123957 predicted 817
4 SASI_Mm01_00123958 predicted 596
5 SASI_Mm01_00123959 predicted 221
6 SASI_Mm01_00123960 predicted 802
7 SASI_Mm01_00123961 predicted 792
8 SASI_Mm01_00123962 predicted 777
9 SASI_Mm01_00123963 predicted 282
10 SASI_Mm01_00123964 predicted 729
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010977
METTL21C MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 21C
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010977.1-754s1c1
Sequence:CCGGCCAGAGTCATCAGTCAAACTTCTCGAGAAGTTTGACTGATGACTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010977.1-213s1c1
Sequence:CCGGGCATTATCGGTTTGCAGGAAACTCGAGTTTCCTGCAAACCGATAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010977.1-322s1c1
Sequence:CCGGGCCGAGGAATTGAATTTCCAACTCGAGTTGGAAATTCAATTCCTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010977.1-198s1c1
Sequence:CCGGCAGCTACACTCAGGAGCATTACTCGAGTAATGCTCCTGAGTGTAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010977.1-730s1c1
Sequence:CCGGGACACAACACTGTTGGCTGAACTCGAGTTCAGCCAACAGTGTTGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010977.1-498s1c1
Sequence:CCGGGCCTGAAGTGAAAGAACTGGTCTCGAGACCAGTTCTTTCACTTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010977.1-680s21c1
Sequence:CCGGTCAGGTTCAGCACCGACTATGCTCGAGCATAGTCGGTGCTGAACCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010977.1-239s21c1
Sequence:CCGGTTGTCATCCAGGAATCCATAGCTCGAGCTATGGATTCCTGGATGACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010977
METTL21C MISSION shRNA shRNA Plasmid DNA
methyltransferase like 21C
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010977.1-754s1c1
Sequence:CCGGCCAGAGTCATCAGTCAAACTTCTCGAGAAGTTTGACTGATGACTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010977.1-213s1c1
Sequence:CCGGGCATTATCGGTTTGCAGGAAACTCGAGTTTCCTGCAAACCGATAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010977.1-322s1c1
Sequence:CCGGGCCGAGGAATTGAATTTCCAACTCGAGTTGGAAATTCAATTCCTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010977.1-198s1c1
Sequence:CCGGCAGCTACACTCAGGAGCATTACTCGAGTAATGCTCCTGAGTGTAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010977.1-730s1c1
Sequence:CCGGGACACAACACTGTTGGCTGAACTCGAGTTCAGCCAACAGTGTTGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010977.1-498s1c1
Sequence:CCGGGCCTGAAGTGAAAGAACTGGTCTCGAGACCAGTTCTTTCACTTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010977.1-680s21c1
Sequence:CCGGTCAGGTTCAGCACCGACTATGCTCGAGCATAGTCGGTGCTGAACCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010977.1-239s21c1
Sequence:CCGGTTGTCATCCAGGAATCCATAGCTCGAGCTATGGATTCCTGGATGACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010977
METTL21C MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 21C
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010977.1-754s1c1
Sequence:CCGGCCAGAGTCATCAGTCAAACTTCTCGAGAAGTTTGACTGATGACTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010977.1-213s1c1
Sequence:CCGGGCATTATCGGTTTGCAGGAAACTCGAGTTTCCTGCAAACCGATAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010977.1-322s1c1
Sequence:CCGGGCCGAGGAATTGAATTTCCAACTCGAGTTGGAAATTCAATTCCTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010977.1-198s1c1
Sequence:CCGGCAGCTACACTCAGGAGCATTACTCGAGTAATGCTCCTGAGTGTAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010977.1-730s1c1
Sequence:CCGGGACACAACACTGTTGGCTGAACTCGAGTTCAGCCAACAGTGTTGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010977.1-498s1c1
Sequence:CCGGGCCTGAAGTGAAAGAACTGGTCTCGAGACCAGTTCTTTCACTTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010977.1-680s21c1
Sequence:CCGGTCAGGTTCAGCACCGACTATGCTCGAGCATAGTCGGTGCTGAACCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010977.1-239s21c1
Sequence:CCGGTTGTCATCCAGGAATCCATAGCTCGAGCTATGGATTCCTGGATGACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013799
METTL21C MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 21C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013799.1-369s21c1
Sequence:CCGGAGACCATACAGAGGAATTAAACTCGAGTTTAATTCCTCTGTATGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013799.1-913s21c1
Sequence:CCGGTGCCACACTGGTATGGCTAAACTCGAGTTTAGCCATACCAGTGTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013799.1-344s21c1
Sequence:CCGGCTACAGCTCTGTGTCAATATTCTCGAGAATATTGACACAGAGCTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013799.1-281s21c1
Sequence:CCGGCAGGCAAGAAGATCATCATTCCTCGAGGAATGATGATCTTCTTGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013799.1-214s21c1
Sequence:CCGGCTTCGTAGCATCCAGAAATTTCTCGAGAAATTTCTGGATGCTACGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013799
METTL21C MISSION shRNA shRNA Plasmid DNA
methyltransferase like 21C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013799.1-369s21c1
Sequence:CCGGAGACCATACAGAGGAATTAAACTCGAGTTTAATTCCTCTGTATGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013799.1-913s21c1
Sequence:CCGGTGCCACACTGGTATGGCTAAACTCGAGTTTAGCCATACCAGTGTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013799.1-344s21c1
Sequence:CCGGCTACAGCTCTGTGTCAATATTCTCGAGAATATTGACACAGAGCTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013799.1-281s21c1
Sequence:CCGGCAGGCAAGAAGATCATCATTCCTCGAGGAATGATGATCTTCTTGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013799.1-214s21c1
Sequence:CCGGCTTCGTAGCATCCAGAAATTTCTCGAGAAATTTCTGGATGCTACGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013799
METTL21C MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 21C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013799.1-369s21c1
Sequence:CCGGAGACCATACAGAGGAATTAAACTCGAGTTTAATTCCTCTGTATGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013799.1-913s21c1
Sequence:CCGGTGCCACACTGGTATGGCTAAACTCGAGTTTAGCCATACCAGTGTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013799.1-344s21c1
Sequence:CCGGCTACAGCTCTGTGTCAATATTCTCGAGAATATTGACACAGAGCTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013799.1-281s21c1
Sequence:CCGGCAGGCAAGAAGATCATCATTCCTCGAGGAATGATGATCTTCTTGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013799.1-214s21c1
Sequence:CCGGCTTCGTAGCATCCAGAAATTTCTCGAGAAATTTCTGGATGCTACGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)