EMAIL THIS PAGE TO A FRIEND

METTL21D

methyltransferase like 21D

94 Gene Product Result for
Synonyms: C14orf138 VCP-KMT
UniProtKB ID: Q9H867, B7ZLA3, B7ZLA4, Q2M2X3, Q86T12
Gene ID:
Mouse(207965) methyltransferase like 21D
Rat(362748) methyltransferase like 21D
Zebrafish(751625) methyltransferase like 21D
chicken(423571) methyltransferase like 21D
cow(540184) methyltransferase like 21D
domestic cat(101093943) methyltransferase like 21D
dog(609034) methyltransferase like 21D
domestic guinea pig(100720624) methyltransferase like 21D
naked mole-rat(101701405) methyltransferase like 21D
sheep(101102313) methyltransferase like 21D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033236 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033236 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033236 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024558 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024558 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024558 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040662 Rosetta Predictions human pricing
NM_024558 Rosetta Predictions human pricing
XM_001080392 Rosetta Predictions rat pricing
XM_343073 Rosetta Predictions rat pricing
NM_001033236 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309048 predicted 1030
2 SASI_Hs01_00085163 predicted 925
3 SASI_Hs01_00085164 predicted 978
4 SASI_Hs01_00085165 predicted 308
5 SASI_Hs01_00085167 predicted 331
6 SASI_Hs01_00085168 predicted 517
7 SASI_Hs01_00085169 predicted 457
8 SASI_Hs01_00085170 predicted 608
9 SASI_Hs01_00085171 predicted 821
10 SASI_Hs01_00085172 predicted 631
11 SASI_Hs01_00085166 predicted 975
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356866 predicted 1138
2 SASI_Hs01_00128221 predicted 1031
3 SASI_Hs01_00128222 predicted 1077
4 SASI_Hs01_00128223 predicted 307
5 SASI_Hs01_00128225 predicted 327
6 SASI_Hs01_00128226 predicted 521
7 SASI_Hs01_00128227 predicted 460
8 SASI_Hs01_00128228 predicted 718
9 SASI_Hs01_00128229 predicted 924
10 SASI_Hs02_00356867 predicted 735
11 SASI_Hs01_00128224 predicted 1089
12 SASI_Hs01_00128230 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080392 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367830 predicted 707
2 SASI_Rn02_00367831 predicted 841
3 SASI_Rn02_00367832 predicted 807
4 SASI_Rn02_00367833 predicted 901
5 SASI_Rn02_00367834 predicted 620
6 SASI_Rn02_00367835 predicted 633
7 SASI_Rn02_00367836 predicted 768
8 SASI_Rn02_00367837 predicted 265
9 SASI_Rn02_00367838 predicted 732
10 SASI_Rn02_00367839 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343073 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395261 predicted 841
2 SASI_Rn02_00395262 predicted 903
3 SASI_Rn02_00395263 predicted 846
4 SASI_Rn02_00395264 predicted 884
5 SASI_Rn02_00395265 predicted 958
6 SASI_Rn02_00395266 predicted 893
7 SASI_Rn02_00395267 predicted 896
8 SASI_Rn02_00395268 predicted 929
9 SASI_Rn02_00395269 predicted 895
10 SASI_Rn02_00395270 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033236 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117804 predicted 521
2 SASI_Mm01_00117805 predicted 666
3 SASI_Mm01_00117806 predicted 641
4 SASI_Mm01_00117808 predicted 582
5 SASI_Mm01_00117809 predicted 525
6 SASI_Mm01_00117810 predicted 387
7 SASI_Mm01_00117811 predicted 798
8 SASI_Mm01_00117812 predicted 761
9 SASI_Mm01_00117813 predicted 383
10 SASI_Mm02_00288363 predicted 786
11 SASI_Mm01_00117807 predicted 306
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033236
VALIDATED
METTL21D MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 21D
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033236.2-398s21c1
Sequence:CCGGTTCAAGCCAAGGTACTGAAATCTCGAGATTTCAGTACCTTGGCTTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033236.2-855s21c1
Sequence:CCGGACATGGATGACAACTACTTTGCTCGAGCAAAGTAGTTGTCATCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033236.2-457s21c1
Sequence:CCGGATATTGATGGCAGACTGTATACTCGAGTATACAGTCTGCCATCAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033236.2-553s21c1
Sequence:CCGGTGTTACGAACAACGTACAATGCTCGAGCATTGTACGTTGTTCGTAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033236.2-669s21c1
Sequence:CCGGCCGAAGTGAAGACATTCATATCTCGAGATATGAATGTCTTCACTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033236
VALIDATED
METTL21D MISSION shRNA shRNA Plasmid DNA
methyltransferase like 21D
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033236.2-398s21c1
Sequence:CCGGTTCAAGCCAAGGTACTGAAATCTCGAGATTTCAGTACCTTGGCTTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033236.2-855s21c1
Sequence:CCGGACATGGATGACAACTACTTTGCTCGAGCAAAGTAGTTGTCATCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033236.2-457s21c1
Sequence:CCGGATATTGATGGCAGACTGTATACTCGAGTATACAGTCTGCCATCAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033236.2-553s21c1
Sequence:CCGGTGTTACGAACAACGTACAATGCTCGAGCATTGTACGTTGTTCGTAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033236.2-669s21c1
Sequence:CCGGCCGAAGTGAAGACATTCATATCTCGAGATATGAATGTCTTCACTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033236
VALIDATED
METTL21D MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 21D
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033236.2-398s21c1
Sequence:CCGGTTCAAGCCAAGGTACTGAAATCTCGAGATTTCAGTACCTTGGCTTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033236.2-855s21c1
Sequence:CCGGACATGGATGACAACTACTTTGCTCGAGCAAAGTAGTTGTCATCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033236.2-457s21c1
Sequence:CCGGATATTGATGGCAGACTGTATACTCGAGTATACAGTCTGCCATCAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033236.2-553s21c1
Sequence:CCGGTGTTACGAACAACGTACAATGCTCGAGCATTGTACGTTGTTCGTAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033236.2-669s21c1
Sequence:CCGGCCGAAGTGAAGACATTCATATCTCGAGATATGAATGTCTTCACTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024558
VALIDATED
METTL21D MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 21D
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024558.2-383s21c1
Sequence:CCGGTTCAAGCCAAGGTACTGAAATCTCGAGATTTCAGTACCTTGGCTTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024558.2-657s21c1
Sequence:CCGGTCGAAGTGAAGATATTCATATCTCGAGATATGAATATCTTCACTTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024558.2-108s21c1
Sequence:CCGGGCTACGACTACAGCAGTATAGCTCGAGCTATACTGCTGTAGTCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024558.2-832s21c1
Sequence:CCGGTCCTTAGAGATCCGATGTATACTCGAGTATACATCGGATCTCTAAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024558.2-448s21c1
Sequence:CCGGCTGATGGCCGACTGCATATACCTCGAGGTATATGCAGTCGGCCATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024558.1-295s1c1
Sequence:CCGGGCTGATGTTGTAGTCACCGATCTCGAGATCGGTGACTACAACATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024558.1-298s1c1
Sequence:CCGGGATGTTGTAGTCACCGATCTTCTCGAGAAGATCGGTGACTACAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024558.1-502s1c1
Sequence:CCGGCAGCGGATTTGAAACTTGTATCTCGAGATACAAGTTTCAAATCCGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024558.1-1424s1c1
Sequence:CCGGGTGAGAATAGAAAGACCAGTTCTCGAGAACTGGTCTTTCTATTCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024558.1-702s1c1
Sequence:CCGGCGTGAAGCCTTTAATCATCTTCTCGAGAAGATGATTAAAGGCTTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024558.1-169s1c1
Sequence:CCGGGTCCTTTCTAAATACCTGGAACTCGAGTTCCAGGTATTTAGAAAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024558.1-364s1c1
Sequence:CCGGCATCTTGTCACTGGTTCTGTTCTCGAGAACAGAACCAGTGACAAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024558
VALIDATED
METTL21D MISSION shRNA shRNA Plasmid DNA
methyltransferase like 21D
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024558.2-383s21c1
Sequence:CCGGTTCAAGCCAAGGTACTGAAATCTCGAGATTTCAGTACCTTGGCTTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024558.2-657s21c1
Sequence:CCGGTCGAAGTGAAGATATTCATATCTCGAGATATGAATATCTTCACTTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024558.2-108s21c1
Sequence:CCGGGCTACGACTACAGCAGTATAGCTCGAGCTATACTGCTGTAGTCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024558.2-832s21c1
Sequence:CCGGTCCTTAGAGATCCGATGTATACTCGAGTATACATCGGATCTCTAAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024558.2-448s21c1
Sequence:CCGGCTGATGGCCGACTGCATATACCTCGAGGTATATGCAGTCGGCCATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024558.1-295s1c1
Sequence:CCGGGCTGATGTTGTAGTCACCGATCTCGAGATCGGTGACTACAACATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024558.1-298s1c1
Sequence:CCGGGATGTTGTAGTCACCGATCTTCTCGAGAAGATCGGTGACTACAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024558.1-502s1c1
Sequence:CCGGCAGCGGATTTGAAACTTGTATCTCGAGATACAAGTTTCAAATCCGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024558.1-1424s1c1
Sequence:CCGGGTGAGAATAGAAAGACCAGTTCTCGAGAACTGGTCTTTCTATTCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024558.1-702s1c1
Sequence:CCGGCGTGAAGCCTTTAATCATCTTCTCGAGAAGATGATTAAAGGCTTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024558.1-169s1c1
Sequence:CCGGGTCCTTTCTAAATACCTGGAACTCGAGTTCCAGGTATTTAGAAAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024558.1-364s1c1
Sequence:CCGGCATCTTGTCACTGGTTCTGTTCTCGAGAACAGAACCAGTGACAAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024558
VALIDATED
METTL21D MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 21D
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024558.2-383s21c1
Sequence:CCGGTTCAAGCCAAGGTACTGAAATCTCGAGATTTCAGTACCTTGGCTTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024558.2-657s21c1
Sequence:CCGGTCGAAGTGAAGATATTCATATCTCGAGATATGAATATCTTCACTTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024558.2-108s21c1
Sequence:CCGGGCTACGACTACAGCAGTATAGCTCGAGCTATACTGCTGTAGTCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024558.2-832s21c1
Sequence:CCGGTCCTTAGAGATCCGATGTATACTCGAGTATACATCGGATCTCTAAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024558.2-448s21c1
Sequence:CCGGCTGATGGCCGACTGCATATACCTCGAGGTATATGCAGTCGGCCATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024558.1-295s1c1
Sequence:CCGGGCTGATGTTGTAGTCACCGATCTCGAGATCGGTGACTACAACATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024558.1-298s1c1
Sequence:CCGGGATGTTGTAGTCACCGATCTTCTCGAGAAGATCGGTGACTACAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024558.1-502s1c1
Sequence:CCGGCAGCGGATTTGAAACTTGTATCTCGAGATACAAGTTTCAAATCCGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024558.1-1424s1c1
Sequence:CCGGGTGAGAATAGAAAGACCAGTTCTCGAGAACTGGTCTTTCTATTCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024558.1-702s1c1
Sequence:CCGGCGTGAAGCCTTTAATCATCTTCTCGAGAAGATGATTAAAGGCTTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024558.1-169s1c1
Sequence:CCGGGTCCTTTCTAAATACCTGGAACTCGAGTTCCAGGTATTTAGAAAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024558.1-364s1c1
Sequence:CCGGCATCTTGTCACTGGTTCTGTTCTCGAGAACAGAACCAGTGACAAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)