EMAIL THIS PAGE TO A FRIEND

METTL23

methyltransferase like 23

58 Gene Product Result for
Synonyms: C17orf95
UniProtKB ID: Q86XA0
Gene ID:
Mouse(74319) methyltransferase like 23
Rat(287918) methyltransferase like 23
domestic guinea pig(100728593) methyltransferase like 23
naked mole-rat(101719672) methyltransferase like 23
chicken(100859394) methyltransferase like 23
dog(100688657) methyltransferase like 23
domestic cat(101086105) methyltransferase like 23
cow(100139217) methyltransferase like 23
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028865 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028865 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028865 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080510 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080510 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080510 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151691 MISSION® esiRNA esiRNA human C17orf95 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080510 Rosetta Predictions human pricing
XM_497558 Rosetta Predictions human pricing
NM_001008283 Rosetta Predictions rat pricing
NM_028865 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080510 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315537 predicted 770
2 SASI_Hs02_00315538 predicted 461
3 SASI_Hs02_00315539 predicted 519
4 SASI_Hs02_00315540 predicted 827
5 SASI_Hs02_00315541 predicted 589
6 SASI_Hs02_00315542 predicted 788
7 SASI_Hs02_00315543 predicted 504
8 SASI_Hs02_00315544 predicted 823
9 SASI_Hs02_00315545 predicted 848
10 SASI_Hs02_00315546 predicted 745
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_497558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248388 predicted 694
2 SASI_Hs01_00248389 predicted 680
3 SASI_Hs01_00248390 predicted 381
4 SASI_Hs01_00248391 predicted 436
5 SASI_Hs01_00248392 predicted 668
6 SASI_Hs01_00248393 predicted 757
7 SASI_Hs01_00248394 predicted 516
8 SASI_Hs01_00248395 predicted 706
9 SASI_Hs01_00248396 predicted 417
10 SASI_Hs01_00248397 predicted 748
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008283 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051318 predicted 516
2 SASI_Rn01_00051319 predicted 291
3 SASI_Rn01_00051320 predicted 540
4 SASI_Rn01_00051322 predicted 575
5 SASI_Rn01_00051323 predicted 487
6 SASI_Rn01_00051324 predicted 659
7 SASI_Rn01_00051325 predicted 555
8 SASI_Rn02_00198983 predicted 527
9 SASI_Rn01_00051326 predicted 299
10 SASI_Rn02_00198984 predicted 240
11 SASI_Rn01_00051321 predicted 678
12 SASI_Rn01_00051327 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028865 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334538 predicted 693
2 SASI_Mm01_00189525 predicted 716
3 SASI_Mm01_00189526 predicted 490
4 SASI_Mm02_00334539 predicted 648
5 SASI_Mm02_00334540 predicted 610
6 SASI_Mm01_00189528 predicted 507
7 SASI_Mm01_00189529 predicted 503
8 SASI_Mm02_00334541 predicted 624
9 SASI_Mm02_00334542 predicted 692
10 SASI_Mm02_00334543 predicted 330
11 SASI_Mm01_00189524 predicted 382
12 SASI_Mm01_00189527 predicted 536
13 SASI_Mm01_00189530 predicted 231
14 SASI_Mm01_00189531 predicted 212
15 SASI_Mm01_00189532 predicted 384
16 SASI_Mm01_00189533 predicted 723
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028865
VALIDATED
METTL23 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 23
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028865.3-259s21c1
Sequence:CCGGAGGTCCTGCATGTCCAGTATGCTCGAGCATACTGGACATGCAGGACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028865.2-356s1c1
Sequence:CCGGGAGTTTCCTCACTGTCTGGATCTCGAGATCCAGACAGTGAGGAAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028865.2-314s1c1
Sequence:CCGGGCTGCCAAATGTGGTGCTAAACTCGAGTTTAGCACCACATTTGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028865.2-709s1c1
Sequence:CCGGCCTTCCAGGAAGACATACTGTCTCGAGACAGTATGTCTTCCTGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028865.2-768s1c1
Sequence:CCGGGAATGAATTGTACCTCAATATCTCGAGATATTGAGGTACAATTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028865.3-893s21c1
Sequence:CCGGATGGAATAACCTGGCATAAAGCTCGAGCTTTATGCCAGGTTATTCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028865.2-385s1c1
Sequence:CCGGGCAAAGTTGCCAGATGAATAACTCGAGTTATTCATCTGGCAACTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028865.2-831s1c1
Sequence:CCGGGAATTATCTGAGGAAACTCAACTCGAGTTGAGTTTCCTCAGATAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028865.2-828s1c1
Sequence:CCGGGCTGAATTATCTGAGGAAACTCTCGAGAGTTTCCTCAGATAATTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028865.2-497s1c1
Sequence:CCGGGATGTGTTCTTTGAACCAGAACTCGAGTTCTGGTTCAAAGAACACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028865.2-513s1c1
Sequence:CCGGCAGAAGACTTTGAAAGCATTTCTCGAGAAATGCTTTCAAAGTCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028865.2-838s1c1
Sequence:CCGGCTGAGGAAACTCAATGGGTATCTCGAGATACCCATTGAGTTTCCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028865.3-852s21c1
Sequence:CCGGTGAATGAATTGTACCTCAATACTCGAGTATTGAGGTACAATTCATTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028865
VALIDATED
METTL23 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 23
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028865.3-259s21c1
Sequence:CCGGAGGTCCTGCATGTCCAGTATGCTCGAGCATACTGGACATGCAGGACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028865.2-356s1c1
Sequence:CCGGGAGTTTCCTCACTGTCTGGATCTCGAGATCCAGACAGTGAGGAAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028865.2-314s1c1
Sequence:CCGGGCTGCCAAATGTGGTGCTAAACTCGAGTTTAGCACCACATTTGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028865.2-709s1c1
Sequence:CCGGCCTTCCAGGAAGACATACTGTCTCGAGACAGTATGTCTTCCTGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028865.2-768s1c1
Sequence:CCGGGAATGAATTGTACCTCAATATCTCGAGATATTGAGGTACAATTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028865.3-893s21c1
Sequence:CCGGATGGAATAACCTGGCATAAAGCTCGAGCTTTATGCCAGGTTATTCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028865.2-385s1c1
Sequence:CCGGGCAAAGTTGCCAGATGAATAACTCGAGTTATTCATCTGGCAACTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028865.2-831s1c1
Sequence:CCGGGAATTATCTGAGGAAACTCAACTCGAGTTGAGTTTCCTCAGATAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028865.2-828s1c1
Sequence:CCGGGCTGAATTATCTGAGGAAACTCTCGAGAGTTTCCTCAGATAATTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028865.2-497s1c1
Sequence:CCGGGATGTGTTCTTTGAACCAGAACTCGAGTTCTGGTTCAAAGAACACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028865.2-513s1c1
Sequence:CCGGCAGAAGACTTTGAAAGCATTTCTCGAGAAATGCTTTCAAAGTCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028865.2-838s1c1
Sequence:CCGGCTGAGGAAACTCAATGGGTATCTCGAGATACCCATTGAGTTTCCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028865.3-852s21c1
Sequence:CCGGTGAATGAATTGTACCTCAATACTCGAGTATTGAGGTACAATTCATTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028865
VALIDATED
METTL23 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 23
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028865.3-259s21c1
Sequence:CCGGAGGTCCTGCATGTCCAGTATGCTCGAGCATACTGGACATGCAGGACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028865.2-356s1c1
Sequence:CCGGGAGTTTCCTCACTGTCTGGATCTCGAGATCCAGACAGTGAGGAAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028865.2-314s1c1
Sequence:CCGGGCTGCCAAATGTGGTGCTAAACTCGAGTTTAGCACCACATTTGGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028865.2-709s1c1
Sequence:CCGGCCTTCCAGGAAGACATACTGTCTCGAGACAGTATGTCTTCCTGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028865.2-768s1c1
Sequence:CCGGGAATGAATTGTACCTCAATATCTCGAGATATTGAGGTACAATTCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028865.3-893s21c1
Sequence:CCGGATGGAATAACCTGGCATAAAGCTCGAGCTTTATGCCAGGTTATTCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028865.2-385s1c1
Sequence:CCGGGCAAAGTTGCCAGATGAATAACTCGAGTTATTCATCTGGCAACTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028865.2-831s1c1
Sequence:CCGGGAATTATCTGAGGAAACTCAACTCGAGTTGAGTTTCCTCAGATAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028865.2-828s1c1
Sequence:CCGGGCTGAATTATCTGAGGAAACTCTCGAGAGTTTCCTCAGATAATTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028865.2-497s1c1
Sequence:CCGGGATGTGTTCTTTGAACCAGAACTCGAGTTCTGGTTCAAAGAACACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028865.2-513s1c1
Sequence:CCGGCAGAAGACTTTGAAAGCATTTCTCGAGAAATGCTTTCAAAGTCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028865.2-838s1c1
Sequence:CCGGCTGAGGAAACTCAATGGGTATCTCGAGATACCCATTGAGTTTCCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028865.3-852s21c1
Sequence:CCGGTGAATGAATTGTACCTCAATACTCGAGTATTGAGGTACAATTCATTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080510
VALIDATED
METTL23 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 23
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080510.2-921s21c1
Sequence:CCGGTGTTCTGGGACAGTATCAATACTCGAGTATTGATACTGTCCCAGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080510.2-601s21c1
Sequence:CCGGCTCTACCACCACAAGATATTACTCGAGTAATATCTTGTGGTGGTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080510.2-516s21c1
Sequence:CCGGTGTCGGCAAAGCTGCCAAATGCTCGAGCATTTGGCAGCTTTGCCGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080510.2-695s21c1
Sequence:CCGGCAAGAATCCCAAGGTCCAATTCTCGAGAATTGGACCTTGGGATTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080510.2-551s21c1
Sequence:CCGGTCTGCAGGTGGTAGGACTAACCTCGAGGTTAGTCCTACCACCTGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080510
VALIDATED
METTL23 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 23
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080510.2-921s21c1
Sequence:CCGGTGTTCTGGGACAGTATCAATACTCGAGTATTGATACTGTCCCAGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080510.2-601s21c1
Sequence:CCGGCTCTACCACCACAAGATATTACTCGAGTAATATCTTGTGGTGGTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080510.2-516s21c1
Sequence:CCGGTGTCGGCAAAGCTGCCAAATGCTCGAGCATTTGGCAGCTTTGCCGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080510.2-695s21c1
Sequence:CCGGCAAGAATCCCAAGGTCCAATTCTCGAGAATTGGACCTTGGGATTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080510.2-551s21c1
Sequence:CCGGTCTGCAGGTGGTAGGACTAACCTCGAGGTTAGTCCTACCACCTGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080510
VALIDATED
METTL23 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 23
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080510.2-921s21c1
Sequence:CCGGTGTTCTGGGACAGTATCAATACTCGAGTATTGATACTGTCCCAGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080510.2-601s21c1
Sequence:CCGGCTCTACCACCACAAGATATTACTCGAGTAATATCTTGTGGTGGTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080510.2-516s21c1
Sequence:CCGGTGTCGGCAAAGCTGCCAAATGCTCGAGCATTTGGCAGCTTTGCCGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080510.2-695s21c1
Sequence:CCGGCAAGAATCCCAAGGTCCAATTCTCGAGAATTGGACCTTGGGATTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080510.2-551s21c1
Sequence:CCGGTCTGCAGGTGGTAGGACTAACCTCGAGGTTAGTCCTACCACCTGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)