EMAIL THIS PAGE TO A FRIEND

METTL24

methyltransferase like 24

65 Gene Product Result for
Synonyms: C6orf186 dJ71D21.2
UniProtKB ID: Q5JXM2, Q6ZSU5
Gene ID:
Mouse(327747) methyltransferase like 24
Rat(499465) methyltransferase like 24
domestic cat(101083339) methyltransferase like 24
dog(612293) methyltransferase like 24
sheep(101107362) methyltransferase like 24
naked mole-rat(101706283) methyltransferase like 24
domestic guinea pig(100731443) methyltransferase like 24
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177793 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177793 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177793 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001123364 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001123364 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001123364 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001123364 Rosetta Predictions human pricing
XM_001725390 Rosetta Predictions human pricing
XM_001726186 Rosetta Predictions human pricing
NM_001025038 Rosetta Predictions rat pricing
NM_177793 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123364 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327804 predicted 792
2 SASI_Hs02_00327805 predicted 547
3 SASI_Hs02_00327806 predicted 647
4 SASI_Hs02_00327807 predicted 840
5 SASI_Hs02_00327808 predicted 595
6 SASI_Hs02_00327809 predicted 596
7 SASI_Hs02_00327810 predicted 539
8 SASI_Hs02_00327811 predicted 602
9 SASI_Hs02_00327812 predicted 626
10 SASI_Hs02_00327813 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00467457 predicted 799
2 SASI_Hs02_00467458 predicted 544
3 SASI_Hs02_00467459 predicted 655
4 SASI_Hs02_00467460 predicted 844
5 SASI_Hs02_00467461 predicted 598
6 SASI_Hs02_00467462 predicted 603
7 SASI_Hs02_00467463 predicted 535
8 SASI_Hs02_00467464 predicted 603
9 SASI_Hs02_00467465 predicted 631
10 SASI_Hs02_00467466 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726186 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00472569 predicted 799
2 SASI_Hs02_00472570 predicted 539
3 SASI_Hs02_00472571 predicted 652
4 SASI_Hs02_00472572 predicted 843
5 SASI_Hs02_00472573 predicted 591
6 SASI_Hs02_00472574 predicted 604
7 SASI_Hs02_00472575 predicted 539
8 SASI_Hs02_00472576 predicted 600
9 SASI_Hs02_00472577 predicted 626
10 SASI_Hs02_00472578 predicted 645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025038 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054791 predicted 1052
2 SASI_Rn01_00054792 predicted 573
3 SASI_Rn01_00054793 predicted 437
4 SASI_Rn01_00054794 predicted 670
5 SASI_Rn01_00054795 predicted 995
6 SASI_Rn01_00054796 predicted 531
7 SASI_Rn01_00054798 predicted 1161
8 SASI_Rn01_00054799 predicted 593
9 SASI_Rn01_00054800 predicted 778
10 SASI_Rn02_00202950 predicted 820
11 SASI_Rn01_00054797 predicted 1190
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177793 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032673 predicted 1111
2 SASI_Mm01_00032674 predicted 813
3 SASI_Mm01_00032675 predicted 445
4 SASI_Mm01_00032676 predicted 733
5 SASI_Mm01_00032677 predicted 707
6 SASI_Mm01_00032678 predicted 467
7 SASI_Mm01_00032679 predicted 1133
8 SASI_Mm01_00032680 predicted 1292
9 SASI_Mm01_00032681 predicted 550
10 SASI_Mm01_00032682 predicted 779
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177793
METTL24 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 24
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177793.3-941s21c1
Sequence:CCGGGCTCGTCTTCGAGATTCATCTCTCGAGAGATGAATCTCGAAGACGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177793.3-489s21c1
Sequence:CCGGTGCGATCACATGGGTACAGACCTCGAGGTCTGTACCCATGTGATCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177793.3-668s21c1
Sequence:CCGGTGGATGTGAAGTGCATCGTTTCTCGAGAAACGATGCACTTCACATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177793.3-1182s21c1
Sequence:CCGGACGTACAGCACAGGTGGATACCTCGAGGTATCCACCTGTGCTGTACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177793.2-1271s1c1
Sequence:CCGGCTTGGGTGATTGTCTCCTGAACTCGAGTTCAGGAGACAATCACCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177793.2-831s1c1
Sequence:CCGGGAATGAATTTGGGCACCACAACTCGAGTTGTGGTGCCCAAATTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177793.2-1136s1c1
Sequence:CCGGCCTTGAGTTGGGTGAATACAACTCGAGTTGTATTCACCCAACTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177793.2-1075s1c1
Sequence:CCGGGACTTAACGAAACCTCAGCTTCTCGAGAAGCTGAGGTTTCGTTAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177793
METTL24 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 24
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177793.3-941s21c1
Sequence:CCGGGCTCGTCTTCGAGATTCATCTCTCGAGAGATGAATCTCGAAGACGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177793.3-489s21c1
Sequence:CCGGTGCGATCACATGGGTACAGACCTCGAGGTCTGTACCCATGTGATCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177793.3-668s21c1
Sequence:CCGGTGGATGTGAAGTGCATCGTTTCTCGAGAAACGATGCACTTCACATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177793.3-1182s21c1
Sequence:CCGGACGTACAGCACAGGTGGATACCTCGAGGTATCCACCTGTGCTGTACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177793.2-1271s1c1
Sequence:CCGGCTTGGGTGATTGTCTCCTGAACTCGAGTTCAGGAGACAATCACCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177793.2-831s1c1
Sequence:CCGGGAATGAATTTGGGCACCACAACTCGAGTTGTGGTGCCCAAATTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177793.2-1136s1c1
Sequence:CCGGCCTTGAGTTGGGTGAATACAACTCGAGTTGTATTCACCCAACTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177793.2-1075s1c1
Sequence:CCGGGACTTAACGAAACCTCAGCTTCTCGAGAAGCTGAGGTTTCGTTAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177793
METTL24 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 24
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177793.3-941s21c1
Sequence:CCGGGCTCGTCTTCGAGATTCATCTCTCGAGAGATGAATCTCGAAGACGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177793.3-489s21c1
Sequence:CCGGTGCGATCACATGGGTACAGACCTCGAGGTCTGTACCCATGTGATCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177793.3-668s21c1
Sequence:CCGGTGGATGTGAAGTGCATCGTTTCTCGAGAAACGATGCACTTCACATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177793.3-1182s21c1
Sequence:CCGGACGTACAGCACAGGTGGATACCTCGAGGTATCCACCTGTGCTGTACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177793.2-1271s1c1
Sequence:CCGGCTTGGGTGATTGTCTCCTGAACTCGAGTTCAGGAGACAATCACCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177793.2-831s1c1
Sequence:CCGGGAATGAATTTGGGCACCACAACTCGAGTTGTGGTGCCCAAATTCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177793.2-1136s1c1
Sequence:CCGGCCTTGAGTTGGGTGAATACAACTCGAGTTGTATTCACCCAACTCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177793.2-1075s1c1
Sequence:CCGGGACTTAACGAAACCTCAGCTTCTCGAGAAGCTGAGGTTTCGTTAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001123364
METTL24 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 24
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123364.1-419s21c1
Sequence:CCGGTTGCATGCAATCACATGAATACTCGAGTATTCATGTGATTGCATGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123364.1-384s21c1
Sequence:CCGGCTGGAGGTTCCTGAGATATATCTCGAGATATATCTCAGGAACCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123364.1-494s21c1
Sequence:CCGGTTGACGACAGGTTCAATTTAGCTCGAGCTAAATTGAACCTGTCGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123364.1-632s21c1
Sequence:CCGGGTGTCAAGTCAGCTCACATTCCTCGAGGAATGTGAGCTGACTTGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123364.1-561s21c1
Sequence:CCGGAGGAAGTGATGATACCCATTTCTCGAGAAATGGGTATCATCACTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001123364
METTL24 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 24
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123364.1-419s21c1
Sequence:CCGGTTGCATGCAATCACATGAATACTCGAGTATTCATGTGATTGCATGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123364.1-384s21c1
Sequence:CCGGCTGGAGGTTCCTGAGATATATCTCGAGATATATCTCAGGAACCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123364.1-494s21c1
Sequence:CCGGTTGACGACAGGTTCAATTTAGCTCGAGCTAAATTGAACCTGTCGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123364.1-632s21c1
Sequence:CCGGGTGTCAAGTCAGCTCACATTCCTCGAGGAATGTGAGCTGACTTGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123364.1-561s21c1
Sequence:CCGGAGGAAGTGATGATACCCATTTCTCGAGAAATGGGTATCATCACTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001123364
METTL24 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 24
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123364.1-419s21c1
Sequence:CCGGTTGCATGCAATCACATGAATACTCGAGTATTCATGTGATTGCATGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123364.1-384s21c1
Sequence:CCGGCTGGAGGTTCCTGAGATATATCTCGAGATATATCTCAGGAACCTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123364.1-494s21c1
Sequence:CCGGTTGACGACAGGTTCAATTTAGCTCGAGCTAAATTGAACCTGTCGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123364.1-632s21c1
Sequence:CCGGGTGTCAAGTCAGCTCACATTCCTCGAGGAATGTGAGCTGACTTGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123364.1-561s21c1
Sequence:CCGGAGGAAGTGATGATACCCATTTCTCGAGAAATGGGTATCATCACTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)