EMAIL THIS PAGE TO A FRIEND

METTL25

methyltransferase like 25

60 Gene Product Result for
Synonyms: C12orf26
UniProtKB ID: Q8N6Q8, Q9H5Y3
Gene ID:
Mouse(216292) methyltransferase like 25
Rat(314798) methyltransferase like 25
domestic guinea pig(100733344) methyltransferase like 25
naked mole-rat(101720402) methyltransferase like 25
sheep(101106247) methyltransferase like 25
Zebrafish(678519) methyltransferase like 25
domestic cat(101093369) methyltransferase like 25
cow(513885) methyltransferase like 25
dog(482583) methyltransferase like 25
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207522 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207522 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207522 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032230 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032230 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032230 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032230 Rosetta Predictions human pricing
NM_001108089 Rosetta Predictions rat pricing
NM_207522 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032230 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024516 predicted 1057
2 SASI_Hs01_00024517 predicted 1608
3 SASI_Hs01_00024519 predicted 1481
4 SASI_Hs01_00024520 predicted 1550
5 SASI_Hs02_00359540 predicted 1015
6 SASI_Hs02_00359541 predicted 487
7 SASI_Hs01_00024521 predicted 1172
8 SASI_Hs01_00024522 predicted 334
9 SASI_Hs02_00359542 predicted 1026
10 SASI_Hs01_00024524 predicted 1665
11 SASI_Hs01_00024518 predicted 1236
12 SASI_Hs01_00024523 predicted 1480
13 SASI_Hs01_00024525 predicted 1685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108089 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235244 predicted 572
2 SASI_Rn02_00235245 predicted 748
3 SASI_Rn02_00235246 predicted 547
4 SASI_Rn02_00235247 predicted 1407
5 SASI_Rn02_00235248 predicted 717
6 SASI_Rn02_00235249 predicted 1207
7 SASI_Rn02_00235250 predicted 566
8 SASI_Rn02_00235251 predicted 1487
9 SASI_Rn02_00235252 predicted 342
10 SASI_Rn02_00235253 predicted 1577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207522 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145981 predicted 1489
2 SASI_Mm02_00352057 predicted 1223
3 SASI_Mm01_00145982 predicted 1591
4 SASI_Mm01_00145983 predicted 481
5 SASI_Mm01_00145984 predicted 515
6 SASI_Mm01_00145985 predicted 546
7 SASI_Mm01_00145986 predicted 705
8 SASI_Mm01_00145988 predicted 1612
9 SASI_Mm01_00145989 predicted 1181
10 SASI_Mm02_00352058 predicted 1553
11 SASI_Mm01_00145987 predicted 526
12 SASI_Mm01_00145990 predicted 679
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207522
VALIDATED
METTL25 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 25
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207522.1-749s1c1
Sequence:CCGGCAGAGAGTTGAAAGTGCCAAACTCGAGTTTGGCACTTTCAACTCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207522.1-1809s1c1
Sequence:CCGGGCTCTGAAGAAGCAGTGTGATCTCGAGATCACACTGCTTCTTCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207522.1-839s21c1
Sequence:CCGGCACCGATGGTTTGCCTGATTTCTCGAGAAATCAGGCAAACCATCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207522.1-1061s21c1
Sequence:CCGGGGCAAGGGACTCAAGCATATACTCGAGTATATGCTTGAGTCCCTTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207522.1-1700s1c1
Sequence:CCGGGATTCTTCTTGATCGACTTTGCTCGAGCAAAGTCGATCAAGAAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207522.1-566s21c1
Sequence:CCGGTTCTGGTAAAGGCTATCTAAGCTCGAGCTTAGATAGCCTTTACCAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207522.1-1609s21c1
Sequence:CCGGTGGACTACTATGAGAATTATACTCGAGTATAATTCTCATAGTAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207522.1-1189s21c1
Sequence:CCGGCCAGTACTCTGCGGATATTTACTCGAGTAAATATCCGCAGAGTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207522
VALIDATED
METTL25 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 25
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207522.1-749s1c1
Sequence:CCGGCAGAGAGTTGAAAGTGCCAAACTCGAGTTTGGCACTTTCAACTCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207522.1-1809s1c1
Sequence:CCGGGCTCTGAAGAAGCAGTGTGATCTCGAGATCACACTGCTTCTTCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207522.1-839s21c1
Sequence:CCGGCACCGATGGTTTGCCTGATTTCTCGAGAAATCAGGCAAACCATCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207522.1-1061s21c1
Sequence:CCGGGGCAAGGGACTCAAGCATATACTCGAGTATATGCTTGAGTCCCTTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207522.1-1700s1c1
Sequence:CCGGGATTCTTCTTGATCGACTTTGCTCGAGCAAAGTCGATCAAGAAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207522.1-566s21c1
Sequence:CCGGTTCTGGTAAAGGCTATCTAAGCTCGAGCTTAGATAGCCTTTACCAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207522.1-1609s21c1
Sequence:CCGGTGGACTACTATGAGAATTATACTCGAGTATAATTCTCATAGTAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207522.1-1189s21c1
Sequence:CCGGCCAGTACTCTGCGGATATTTACTCGAGTAAATATCCGCAGAGTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207522
VALIDATED
METTL25 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 25
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207522.1-749s1c1
Sequence:CCGGCAGAGAGTTGAAAGTGCCAAACTCGAGTTTGGCACTTTCAACTCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207522.1-1809s1c1
Sequence:CCGGGCTCTGAAGAAGCAGTGTGATCTCGAGATCACACTGCTTCTTCAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207522.1-839s21c1
Sequence:CCGGCACCGATGGTTTGCCTGATTTCTCGAGAAATCAGGCAAACCATCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207522.1-1061s21c1
Sequence:CCGGGGCAAGGGACTCAAGCATATACTCGAGTATATGCTTGAGTCCCTTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207522.1-1700s1c1
Sequence:CCGGGATTCTTCTTGATCGACTTTGCTCGAGCAAAGTCGATCAAGAAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207522.1-566s21c1
Sequence:CCGGTTCTGGTAAAGGCTATCTAAGCTCGAGCTTAGATAGCCTTTACCAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207522.1-1609s21c1
Sequence:CCGGTGGACTACTATGAGAATTATACTCGAGTATAATTCTCATAGTAGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207522.1-1189s21c1
Sequence:CCGGCCAGTACTCTGCGGATATTTACTCGAGTAAATATCCGCAGAGTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032230
VALIDATED
METTL25 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 25
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032230.1-106s1c1
Sequence:CCGGGATGCCCTGTCCATTTCCAATCTCGAGATTGGAAATGGACAGGGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032230.1-1767s1c1
Sequence:CCGGGAAGTTGTTTGATCCCGTGAACTCGAGTTCACGGGATCAAACAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032230.1-1572s1c1
Sequence:CCGGGCTTGGATTAGATGAGTCCAACTCGAGTTGGACTCATCTAATCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032230.1-787s1c1
Sequence:CCGGGCTGATACTGAGGAAGTGTTTCTCGAGAAACACTTCCTCAGTATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032230.2-1403s21c1
Sequence:CCGGGATGGTGCTGTGGTCGTAATGCTCGAGCATTACGACCACAGCACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032230.2-1884s21c1
Sequence:CCGGTCCATTGAAGCAAATTATTAGCTCGAGCTAATAATTTGCTTCAATGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032230.2-390s21c1
Sequence:CCGGCTTTGCTCTGGCTGCGAAATACTCGAGTATTTCGCAGCCAGAGCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032230.2-1662s21c1
Sequence:CCGGGAACTACTACGAGAAGTATAACTCGAGTTATACTTCTCGTAGTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032230.2-1752s21c1
Sequence:CCGGGATTCTTCTGGATCGACTTTGCTCGAGCAAAGTCGATCCAGAAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032230.2-1922s21c1
Sequence:CCGGACCTGTTGCTGAGATTGCTTTCTCGAGAAAGCAATCTCAGCAACAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032230
VALIDATED
METTL25 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 25
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032230.1-106s1c1
Sequence:CCGGGATGCCCTGTCCATTTCCAATCTCGAGATTGGAAATGGACAGGGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032230.1-1767s1c1
Sequence:CCGGGAAGTTGTTTGATCCCGTGAACTCGAGTTCACGGGATCAAACAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032230.1-1572s1c1
Sequence:CCGGGCTTGGATTAGATGAGTCCAACTCGAGTTGGACTCATCTAATCCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032230.1-787s1c1
Sequence:CCGGGCTGATACTGAGGAAGTGTTTCTCGAGAAACACTTCCTCAGTATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032230.2-1403s21c1
Sequence:CCGGGATGGTGCTGTGGTCGTAATGCTCGAGCATTACGACCACAGCACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032230.2-1884s21c1
Sequence:CCGGTCCATTGAAGCAAATTATTAGCTCGAGCTAATAATTTGCTTCAATGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032230.2-390s21c1
Sequence:CCGGCTTTGCTCTGGCTGCGAAATACTCGAGTATTTCGCAGCCAGAGCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032230.2-1662s21c1
Sequence:CCGGGAACTACTACGAGAAGTATAACTCGAGTTATACTTCTCGTAGTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032230.2-1752s21c1
Sequence:CCGGGATTCTTCTGGATCGACTTTGCTCGAGCAAAGTCGATCCAGAAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032230.2-1922s21c1
Sequence:CCGGACCTGTTGCTGAGATTGCTTTCTCGAGAAAGCAATCTCAGCAACAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032230
VALIDATED
METTL25 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 25
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032230.1-106s1c1
Sequence:CCGGGATGCCCTGTCCATTTCCAATCTCGAGATTGGAAATGGACAGGGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032230.1-1767s1c1
Sequence:CCGGGAAGTTGTTTGATCCCGTGAACTCGAGTTCACGGGATCAAACAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032230.1-1572s1c1
Sequence:CCGGGCTTGGATTAGATGAGTCCAACTCGAGTTGGACTCATCTAATCCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032230.1-787s1c1
Sequence:CCGGGCTGATACTGAGGAAGTGTTTCTCGAGAAACACTTCCTCAGTATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032230.2-1403s21c1
Sequence:CCGGGATGGTGCTGTGGTCGTAATGCTCGAGCATTACGACCACAGCACCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032230.2-1884s21c1
Sequence:CCGGTCCATTGAAGCAAATTATTAGCTCGAGCTAATAATTTGCTTCAATGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032230.2-390s21c1
Sequence:CCGGCTTTGCTCTGGCTGCGAAATACTCGAGTATTTCGCAGCCAGAGCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032230.2-1662s21c1
Sequence:CCGGGAACTACTACGAGAAGTATAACTCGAGTTATACTTCTCGTAGTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032230.2-1752s21c1
Sequence:CCGGGATTCTTCTGGATCGACTTTGCTCGAGCAAAGTCGATCCAGAAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032230.2-1922s21c1
Sequence:CCGGACCTGTTGCTGAGATTGCTTTCTCGAGAAAGCAATCTCAGCAACAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)