EMAIL THIS PAGE TO A FRIEND

METTL2A

methyltransferase like 2A

12 Gene Product Result for
Synonyms: METTL2
UniProtKB ID: Q96IZ6, A6NNC4, Q9H9G9, Q9NUI8, Q9P0B5
Gene ID:
Zebrafish(100006618) methyltransferase like 2A
domestic cat(101081845) methyltransferase like 2A
dog(480485) methyltransferase like 2A
chicken(419948) methyltransferase like 2A
naked mole-rat(101700171) methyltransferase like 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301038 ANTI-METTL2 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181725 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181725 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181725 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181725 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370336 predicted 371
2 SASI_Hs02_00370337 predicted 379
3 SASI_Hs01_00139820 predicted 1164
4 SASI_Hs01_00139821 predicted 1166
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181725
VALIDATED
METTL2A MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 2A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181725.1-942s1c1
Sequence:CCGGGAGGTGATGGAACCAGAGTTTCTCGAGAAACTCTGGTTCCATCACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181725.1-744s1c1
Sequence:CCGGCCAAGGGCAGTCTTGATATTACTCGAGTAATATCAAGACTGCCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181725.1-659s1c1
Sequence:CCGGGTCCAGACAAATTCAGAATATCTCGAGATATTCTGAATTTGTCTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181725.1-467s1c1
Sequence:CCGGGAGGAGAATGTAACTCAGAAACTCGAGTTTCTGAGTTACATTCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181725.1-614s1c1
Sequence:CCGGCTCTTTGTTTATTGCTGTGATCTCGAGATCACAGCAATAAACAAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181725.1-494s1c1
Sequence:CCGGGACCTGGAAATTTGTGCTGATCTCGAGATCAGCACAAATTTCCAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181725.1-1054s1c1
Sequence:CCGGCCGAGGAAAGCAACTGACAATCTCGAGATTGTCAGTTGCTTTCCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181725.1-1346s1c1
Sequence:CCGGGTCTCGTTGATGTTGGACAATCTCGAGATTGTCCAACATCAACGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159904    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181725.1-1649s1c1
Sequence:CCGGGCTAGGCAATTGCAGTTAATACTCGAGTATTAACTGCAATTGCCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181725.1-912s1c1
Sequence:CCGGGTCAGTGTCTATCTGGAAATTCTCGAGAATTTCCAGATAGACACTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181725
VALIDATED
METTL2A MISSION shRNA shRNA Plasmid DNA
methyltransferase like 2A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181725.1-942s1c1
Sequence:CCGGGAGGTGATGGAACCAGAGTTTCTCGAGAAACTCTGGTTCCATCACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181725.1-744s1c1
Sequence:CCGGCCAAGGGCAGTCTTGATATTACTCGAGTAATATCAAGACTGCCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181725.1-659s1c1
Sequence:CCGGGTCCAGACAAATTCAGAATATCTCGAGATATTCTGAATTTGTCTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181725.1-467s1c1
Sequence:CCGGGAGGAGAATGTAACTCAGAAACTCGAGTTTCTGAGTTACATTCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181725.1-614s1c1
Sequence:CCGGCTCTTTGTTTATTGCTGTGATCTCGAGATCACAGCAATAAACAAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181725.1-494s1c1
Sequence:CCGGGACCTGGAAATTTGTGCTGATCTCGAGATCAGCACAAATTTCCAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181725.1-1054s1c1
Sequence:CCGGCCGAGGAAAGCAACTGACAATCTCGAGATTGTCAGTTGCTTTCCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181725.1-1346s1c1
Sequence:CCGGGTCTCGTTGATGTTGGACAATCTCGAGATTGTCCAACATCAACGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159904    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181725.1-1649s1c1
Sequence:CCGGGCTAGGCAATTGCAGTTAATACTCGAGTATTAACTGCAATTGCCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181725.1-912s1c1
Sequence:CCGGGTCAGTGTCTATCTGGAAATTCTCGAGAATTTCCAGATAGACACTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181725
VALIDATED
METTL2A MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 2A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181725.1-942s1c1
Sequence:CCGGGAGGTGATGGAACCAGAGTTTCTCGAGAAACTCTGGTTCCATCACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181725.1-744s1c1
Sequence:CCGGCCAAGGGCAGTCTTGATATTACTCGAGTAATATCAAGACTGCCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181725.1-659s1c1
Sequence:CCGGGTCCAGACAAATTCAGAATATCTCGAGATATTCTGAATTTGTCTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181725.1-467s1c1
Sequence:CCGGGAGGAGAATGTAACTCAGAAACTCGAGTTTCTGAGTTACATTCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181725.1-614s1c1
Sequence:CCGGCTCTTTGTTTATTGCTGTGATCTCGAGATCACAGCAATAAACAAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181725.1-494s1c1
Sequence:CCGGGACCTGGAAATTTGTGCTGATCTCGAGATCAGCACAAATTTCCAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181725.1-1054s1c1
Sequence:CCGGCCGAGGAAAGCAACTGACAATCTCGAGATTGTCAGTTGCTTTCCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181725.1-1346s1c1
Sequence:CCGGGTCTCGTTGATGTTGGACAATCTCGAGATTGTCCAACATCAACGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159904    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181725.1-1649s1c1
Sequence:CCGGGCTAGGCAATTGCAGTTAATACTCGAGTATTAACTGCAATTGCCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181725.1-912s1c1
Sequence:CCGGGTCAGTGTCTATCTGGAAATTCTCGAGAATTTCCAGATAGACACTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)