EMAIL THIS PAGE TO A FRIEND

METTL2B

methyltransferase like 2B

24 Gene Product Result for
Synonyms: METL METTL2 METTL2A PSENIP1
UniProtKB ID: Q6P1Q9, B4DZ68, Q0IJ54, Q3B7J1
Gene ID:
Human(55798) Summary: This gene is a member of a family of methyltransferases that share homology with, but are distinct from, the UbiE family of methyltransferases. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
Rat(363687) methyltransferase like 2B
domestic guinea pig(100732464) methyltransferase like 2B
cow(506221) methyltransferase like 2B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1407697 Anti-METTL2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
AV48836 Anti-METTL2B (AB1) antibody produced in rabbit affinity isolated antibody rabbit, guinea pig, rat, canine, zebrafish, mouse, human, bovine, horse
western blot pricing
AV48837 Anti-METTL2B (AB2) antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, mouse, canine, horse, human, bovine, rat
western blot pricing
SAB1403302 Monoclonal Anti-METTL2 antibody produced in mouse clone 2A9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018396 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018396 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018396 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018396 Rosetta Predictions human pricing
NM_001108839 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018396 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013561 predicted 887
2 SASI_Hs01_00013562 predicted 398
3 SASI_Hs01_00013563 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108839 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242585 predicted 1142
2 SASI_Rn02_00242586 predicted 1216
3 SASI_Rn02_00242587 predicted 1026
4 SASI_Rn02_00242588 predicted 857
5 SASI_Rn02_00242589 predicted 1141
6 SASI_Rn02_00242590 predicted 862
7 SASI_Rn02_00242591 predicted 938
8 SASI_Rn02_00242592 predicted 289
9 SASI_Rn02_00242593 predicted 304
10 SASI_Rn02_00242594 predicted 1130
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018396
VALIDATED
METTL2B MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 2B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018396.1-574s1c1
Sequence:CCGGGTCCAGACAAATTCAGAATATCTCGAGATATTCTGAATTTGTCTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018396.1-994s1c1
Sequence:CCGGCGGGTTTGGATTCAGTGCAAACTCGAGTTTGCACTGAATCCAAACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018396.1-132s1c1
Sequence:CCGGCCACAAATACTGGAATGACTTCTCGAGAAGTCATTCCAGTATTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018396.1-659s1c1
Sequence:CCGGCCAAGGGCAGTCTTGATATTACTCGAGTAATATCAAGACTGCCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018396.2-401s21c1
Sequence:CCGGGAAGTATGTGAATGTAGAAACCTCGAGGTTTCTACATTCACATACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018396.2-895s21c1
Sequence:CCGGGATGGTACTTCTGCGAGATTACTCGAGTAATCTCGCAGAAGTACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018396.2-1592s21c1
Sequence:CCGGACCTTAAACCACCATTTATTTCTCGAGAAATAAATGGTGGTTTAAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018396
VALIDATED
METTL2B MISSION shRNA shRNA Plasmid DNA
methyltransferase like 2B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018396.1-574s1c1
Sequence:CCGGGTCCAGACAAATTCAGAATATCTCGAGATATTCTGAATTTGTCTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018396.1-994s1c1
Sequence:CCGGCGGGTTTGGATTCAGTGCAAACTCGAGTTTGCACTGAATCCAAACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018396.1-132s1c1
Sequence:CCGGCCACAAATACTGGAATGACTTCTCGAGAAGTCATTCCAGTATTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018396.1-659s1c1
Sequence:CCGGCCAAGGGCAGTCTTGATATTACTCGAGTAATATCAAGACTGCCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018396.2-401s21c1
Sequence:CCGGGAAGTATGTGAATGTAGAAACCTCGAGGTTTCTACATTCACATACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018396.2-895s21c1
Sequence:CCGGGATGGTACTTCTGCGAGATTACTCGAGTAATCTCGCAGAAGTACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018396.2-1592s21c1
Sequence:CCGGACCTTAAACCACCATTTATTTCTCGAGAAATAAATGGTGGTTTAAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018396
VALIDATED
METTL2B MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 2B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018396.1-574s1c1
Sequence:CCGGGTCCAGACAAATTCAGAATATCTCGAGATATTCTGAATTTGTCTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018396.1-994s1c1
Sequence:CCGGCGGGTTTGGATTCAGTGCAAACTCGAGTTTGCACTGAATCCAAACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018396.1-132s1c1
Sequence:CCGGCCACAAATACTGGAATGACTTCTCGAGAAGTCATTCCAGTATTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018396.1-659s1c1
Sequence:CCGGCCAAGGGCAGTCTTGATATTACTCGAGTAATATCAAGACTGCCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018396.2-401s21c1
Sequence:CCGGGAAGTATGTGAATGTAGAAACCTCGAGGTTTCTACATTCACATACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018396.2-895s21c1
Sequence:CCGGGATGGTACTTCTGCGAGATTACTCGAGTAATCTCGCAGAAGTACCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018396.2-1592s21c1
Sequence:CCGGACCTTAAACCACCATTTATTTCTCGAGAAATAAATGGTGGTTTAAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)