EMAIL THIS PAGE TO A FRIEND

METTL3

methyltransferase like 3

65 Gene Product Result for
Synonyms: IME4 M6A MT-A70 Spo8
UniProtKB ID: Q86U44, O14736, Q86V05, Q9HB32
Gene ID:
Human(56339) Summary: This gene encodes the 70 kDa subunit of MT-A which is part of N6-adenosine-methyltransferase. This enzyme is involved in the posttranscriptional methylation of internal adenosine residues in eukaryotic mRNAs, forming N6-methyladenosine. [provided by RefSeq, Jul 2008]
Mouse(56335) methyltransferase like 3
Rat(361035) methyltransferase-like 3
Zebrafish(100004398) methyltransferase like 3
dog(475404) methyltransferase like 3
cow(540339) methyltransferase like 3
Horse(100059413) methyltransferase like 3
domestic cat(101099304) methyltransferase like 3
domestic guinea pig(100712853) methyltransferase like 3
naked mole-rat(101700628) methyltransferase like 3
Domestic Rabbit(100353801) methyltransferase like 3
Goat(100861319) methyltransferase like 3
sheep(101108050) methyltransferase like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV34590 Anti-METTL3 (AB1) antibody produced in rabbit IgG fraction of antiserum rabbit, bovine, dog, horse, human, guinea pig, mouse, goat, rat
western blot pricing
AV39390 Anti-METTL3 (AB2) antibody produced in rabbit IgG fraction of antiserum bovine, rabbit, dog, horse, human, rat, mouse, guinea pig
immunohistochemistry, western blot pricing
HPA001299 Anti-METTL3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2104747 Anti-METTL3 antibody produced in rabbit affinity isolated antibody guinea pig, human, bovine, horse, mouse, dog, rabbit, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019852 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019852 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019852 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019721 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019721 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019721 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063661 MISSION® esiRNA esiRNA human METTL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019852 Rosetta Predictions human pricing
NM_001024794 Rosetta Predictions rat pricing
NM_019721 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044317 predicted 826
2 SASI_Hs01_00044318 predicted 977
3 SASI_Hs01_00044319 predicted 907
4 SASI_Hs01_00044320 predicted 789
5 SASI_Hs01_00044321 predicted 1467
6 SASI_Hs01_00044322 predicted 345
7 SASI_Hs01_00044323 predicted 1003
8 SASI_Hs01_00044324 predicted 437
9 SASI_Hs01_00044325 predicted 1537
10 SASI_Hs01_00044326 predicted 548
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024794 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046984 predicted 257
2 SASI_Rn01_00046985 predicted 991
3 SASI_Rn02_00202703 predicted 883
4 SASI_Rn01_00046987 predicted 977
5 SASI_Rn01_00046988 predicted 677
6 SASI_Rn01_00046989 predicted 798
7 SASI_Rn01_00046991 predicted 449
8 SASI_Rn01_00046992 predicted 1608
9 SASI_Rn01_00046993 predicted 1442
10 SASI_Rn02_00202704 predicted 332
11 SASI_Rn01_00046986 predicted 1603
12 SASI_Rn01_00046990 predicted 954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019721 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161770 predicted 744
2 SASI_Mm01_00161771 predicted 1585
3 SASI_Mm01_00161773 predicted 1510
4 SASI_Mm01_00161774 predicted 1118
5 SASI_Mm01_00161775 predicted 866
6 SASI_Mm01_00161776 predicted 1654
7 SASI_Mm02_00324846 predicted 1025
8 SASI_Mm01_00161777 predicted 894
9 SASI_Mm01_00161778 predicted 823
10 SASI_Mm01_00161779 predicted 1362
11 SASI_Mm01_00161772 predicted 1770
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019852
VALIDATED
METTL3 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_019852.3-360s21c1
Sequence:CCGGGCCTTAACATTGCCCACTGATCTCGAGATCAGTGGGCAATGTTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_019852.3-1069s21c1
Sequence:CCGGGCAAGTATGTTCACTATGAAACTCGAGTTTCATAGTGAACATACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_019852.3-980s21c1
Sequence:CCGGGCTGCACTTCAGACGAATTATCTCGAGATAATTCGTCTGAAGTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019852.2-974s1c1
Sequence:CCGGGCTGCACTTCAGACGAATTATCTCGAGATAATTCGTCTGAAGTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_019852.2-849s1c1
Sequence:CCGGGCCAAGGAACAATCCATTGTTCTCGAGAACAATGGATTGTTCCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_019852.2-1063s1c1
Sequence:CCGGGCAAGTATGTTCACTATGAAACTCGAGTTTCATAGTGAACATACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_019852.2-354s1c1
Sequence:CCGGGCCTTAACATTGCCCACTGATCTCGAGATCAGTGGGCAATGTTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_019852.3-1238s21c1
Sequence:CCGGCGTCAGTATCTTGGGCAAGTTCTCGAGAACTTGCCCAAGATACTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_019852.3-855s21c1
Sequence:CCGGGCCAAGGAACAATCCATTGTTCTCGAGAACAATGGATTGTTCCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019852
VALIDATED
METTL3 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_019852.3-360s21c1
Sequence:CCGGGCCTTAACATTGCCCACTGATCTCGAGATCAGTGGGCAATGTTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_019852.3-1069s21c1
Sequence:CCGGGCAAGTATGTTCACTATGAAACTCGAGTTTCATAGTGAACATACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_019852.3-980s21c1
Sequence:CCGGGCTGCACTTCAGACGAATTATCTCGAGATAATTCGTCTGAAGTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019852.2-974s1c1
Sequence:CCGGGCTGCACTTCAGACGAATTATCTCGAGATAATTCGTCTGAAGTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_019852.2-849s1c1
Sequence:CCGGGCCAAGGAACAATCCATTGTTCTCGAGAACAATGGATTGTTCCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_019852.2-1063s1c1
Sequence:CCGGGCAAGTATGTTCACTATGAAACTCGAGTTTCATAGTGAACATACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_019852.2-354s1c1
Sequence:CCGGGCCTTAACATTGCCCACTGATCTCGAGATCAGTGGGCAATGTTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_019852.3-1238s21c1
Sequence:CCGGCGTCAGTATCTTGGGCAAGTTCTCGAGAACTTGCCCAAGATACTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_019852.3-855s21c1
Sequence:CCGGGCCAAGGAACAATCCATTGTTCTCGAGAACAATGGATTGTTCCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019852
VALIDATED
METTL3 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_019852.3-360s21c1
Sequence:CCGGGCCTTAACATTGCCCACTGATCTCGAGATCAGTGGGCAATGTTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_019852.3-1069s21c1
Sequence:CCGGGCAAGTATGTTCACTATGAAACTCGAGTTTCATAGTGAACATACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_019852.3-980s21c1
Sequence:CCGGGCTGCACTTCAGACGAATTATCTCGAGATAATTCGTCTGAAGTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019852.2-974s1c1
Sequence:CCGGGCTGCACTTCAGACGAATTATCTCGAGATAATTCGTCTGAAGTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_019852.2-849s1c1
Sequence:CCGGGCCAAGGAACAATCCATTGTTCTCGAGAACAATGGATTGTTCCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_019852.2-1063s1c1
Sequence:CCGGGCAAGTATGTTCACTATGAAACTCGAGTTTCATAGTGAACATACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_019852.2-354s1c1
Sequence:CCGGGCCTTAACATTGCCCACTGATCTCGAGATCAGTGGGCAATGTTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_019852.3-1238s21c1
Sequence:CCGGCGTCAGTATCTTGGGCAAGTTCTCGAGAACTTGCCCAAGATACTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_019852.3-855s21c1
Sequence:CCGGGCCAAGGAACAATCCATTGTTCTCGAGAACAATGGATTGTTCCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019721
VALIDATED
METTL3 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000039110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019721.1-588s1c1
Sequence:CCGGGCAGAGCAAGAGACGAATTATCTCGAGATAATTCGTCTCTTGCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019721.1-1280s1c1
Sequence:CCGGGCACCCGCAAGATTGAGTTATCTCGAGATAACTCAATCTTGCGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019721.1-846s1c1
Sequence:CCGGCGTCAGTATCTTGGGCAAATTCTCGAGAATTTGCCCAAGATACTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019721.1-811s1c1
Sequence:CCGGCCTCAGTGGATCTGTTGTGATCTCGAGATCACAACAGATCCACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019721
VALIDATED
METTL3 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000039110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019721.1-588s1c1
Sequence:CCGGGCAGAGCAAGAGACGAATTATCTCGAGATAATTCGTCTCTTGCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019721.1-1280s1c1
Sequence:CCGGGCACCCGCAAGATTGAGTTATCTCGAGATAACTCAATCTTGCGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019721.1-846s1c1
Sequence:CCGGCGTCAGTATCTTGGGCAAATTCTCGAGAATTTGCCCAAGATACTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019721.1-811s1c1
Sequence:CCGGCCTCAGTGGATCTGTTGTGATCTCGAGATCACAACAGATCCACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019721
VALIDATED
METTL3 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000039110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019721.1-588s1c1
Sequence:CCGGGCAGAGCAAGAGACGAATTATCTCGAGATAATTCGTCTCTTGCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019721.1-1280s1c1
Sequence:CCGGGCACCCGCAAGATTGAGTTATCTCGAGATAACTCAATCTTGCGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019721.1-846s1c1
Sequence:CCGGCGTCAGTATCTTGGGCAAATTCTCGAGAATTTGCCCAAGATACTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019721.1-811s1c1
Sequence:CCGGCCTCAGTGGATCTGTTGTGATCTCGAGATCACAACAGATCCACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)