EMAIL THIS PAGE TO A FRIEND

METTL4

methyltransferase like 4

164 Gene Product Result for
Synonyms: HsT661
UniProtKB ID: Q8N3J2, B2RNA1, Q2TAA7, Q9H5U9
Gene ID:
Mouse(76781) methyltransferase like 4
Rat(316731) methyltransferase like 4
sheep(100913156) methyltransferase like 4
naked mole-rat(101724336) methyltransferase like 4
domestic guinea pig(100730430) methyltransferase like 4
chicken(421056) methyltransferase like 4
dog(490534) methyltransferase like 4
domestic cat(101088958) methyltransferase like 4
cow(521222) methyltransferase like 4
Horse(100061890) methyltransferase like 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022840 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022840 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022840 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176917 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176917 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176917 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022840 Rosetta Predictions human pricing
XM_001056749 Rosetta Predictions rat pricing
XM_237515 Rosetta Predictions rat pricing
NM_176917 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195786 predicted 2190
2 SASI_Hs02_00356155 predicted 1703
3 SASI_Hs01_00195787 predicted 792
4 SASI_Hs01_00195788 predicted 808
5 SASI_Hs02_00356156 predicted 904
6 SASI_Hs01_00195789 predicted 1714
7 SASI_Hs01_00195792 predicted 2251
8 SASI_Hs01_00195793 predicted 1459
9 SASI_Hs01_00195794 predicted 1146
10 SASI_Hs01_00195795 predicted 1696
11 SASI_Hs01_00195790 predicted 877
12 SASI_Hs01_00195791 predicted 1733
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056749 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284286 predicted 885
2 SASI_Rn02_00284287 predicted 426
3 SASI_Rn02_00284288 predicted 813
4 SASI_Rn02_00284289 predicted 1309
5 SASI_Rn02_00284290 predicted 684
6 SASI_Rn02_00284291 predicted 1442
7 SASI_Rn02_00284292 predicted 429
8 SASI_Rn02_00284293 predicted 1160
9 SASI_Rn02_00284294 predicted 466
10 SASI_Rn02_00284295 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237515 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390959 predicted 1443
2 SASI_Rn02_00390960 predicted 1352
3 SASI_Rn02_00390961 predicted 1611
4 SASI_Rn02_00390962 predicted 1707
5 SASI_Rn02_00390963 predicted 1306
6 SASI_Rn02_00390964 predicted 1480
7 SASI_Rn02_00390965 predicted 1470
8 SASI_Rn02_00390966 predicted 1396
9 SASI_Rn02_00390967 predicted 1585
10 SASI_Rn02_00390968 predicted 1574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176917 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184761 predicted 1129
2 SASI_Mm02_00346795 predicted 871
3 SASI_Mm01_00184762 predicted 1738
4 SASI_Mm01_00184763 predicted 777
5 SASI_Mm01_00184764 predicted 1037
6 SASI_Mm01_00184765 predicted 1153
7 SASI_Mm01_00184766 predicted 1247
8 SASI_Mm01_00184767 predicted 1447
9 SASI_Mm01_00184768 predicted 978
10 SASI_Mm01_00184769 predicted 1577
11 SASI_Mm01_00184770 predicted 1242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022840
VALIDATED
METTL4 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034829    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_022840.2-2966s1c1
Sequence:CCGGGCAGCAAGTAAACAGTGTGATCTCGAGATCACACTGTTTACTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_022840.2-1691s1c1
Sequence:CCGGGCAAATACCTATCCCTAAATTCTCGAGAATTTAGGGATAGGTATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022840.2-1862s1c1
Sequence:CCGGCCCATTAGATTCTCCACACAACTCGAGTTGTGTGGAGAATCTAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_022840.2-1999s1c1
Sequence:CCGGCCTGTACTCTTCACTCACATACTCGAGTATGTGAGTGAAGAGTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_022840.2-1344s1c1
Sequence:CCGGGCCTGCAGTTTGTCAGAATTACTCGAGTAATTCTGACAAACTGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022840
VALIDATED
METTL4 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034829    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_022840.2-2966s1c1
Sequence:CCGGGCAGCAAGTAAACAGTGTGATCTCGAGATCACACTGTTTACTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_022840.2-1691s1c1
Sequence:CCGGGCAAATACCTATCCCTAAATTCTCGAGAATTTAGGGATAGGTATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022840.2-1862s1c1
Sequence:CCGGCCCATTAGATTCTCCACACAACTCGAGTTGTGTGGAGAATCTAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_022840.2-1999s1c1
Sequence:CCGGCCTGTACTCTTCACTCACATACTCGAGTATGTGAGTGAAGAGTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_022840.2-1344s1c1
Sequence:CCGGGCCTGCAGTTTGTCAGAATTACTCGAGTAATTCTGACAAACTGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022840
VALIDATED
METTL4 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034829    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_022840.2-2966s1c1
Sequence:CCGGGCAGCAAGTAAACAGTGTGATCTCGAGATCACACTGTTTACTTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_022840.2-1691s1c1
Sequence:CCGGGCAAATACCTATCCCTAAATTCTCGAGAATTTAGGGATAGGTATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022840.2-1862s1c1
Sequence:CCGGCCCATTAGATTCTCCACACAACTCGAGTTGTGTGGAGAATCTAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_022840.2-1999s1c1
Sequence:CCGGCCTGTACTCTTCACTCACATACTCGAGTATGTGAGTGAAGAGTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_022840.2-1344s1c1
Sequence:CCGGGCCTGCAGTTTGTCAGAATTACTCGAGTAATTCTGACAAACTGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176917
METTL4 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176917.3-1145s1c1
Sequence:CCGGGCCTGCAATTTATCAGAGTTACTCGAGTAACTCTGATAAATTGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176917.3-1483s1c1
Sequence:CCGGGCAGATAAAGCGAATGCCTATCTCGAGATAGGCATTCGCTTTATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184119    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176917.3-1996s1c1
Sequence:CCGGCTGTCTTTACCTCAGCTCCTTCTCGAGAAGGAGCTGAGGTAAAGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176917.4-825s21c1
Sequence:CCGGTTTCCGATCTGAGCTATTTAACTCGAGTTAAATAGCTCAGATCGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176917.4-1934s21c1
Sequence:CCGGAGTTTCAGCACATGGATTATTCTCGAGAATAATCCATGTGCTGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176917.4-1995s21c1
Sequence:CCGGCTGTCTTTACCTCAGCTCCTTCTCGAGAAGGAGCTGAGGTAAAGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176917.4-1114s21c1
Sequence:CCGGAGTAGCGGATGCATCACTTTACTCGAGTAAAGTGATGCATCCGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176917
METTL4 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176917.3-1145s1c1
Sequence:CCGGGCCTGCAATTTATCAGAGTTACTCGAGTAACTCTGATAAATTGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176917.3-1483s1c1
Sequence:CCGGGCAGATAAAGCGAATGCCTATCTCGAGATAGGCATTCGCTTTATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184119    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176917.3-1996s1c1
Sequence:CCGGCTGTCTTTACCTCAGCTCCTTCTCGAGAAGGAGCTGAGGTAAAGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176917.4-825s21c1
Sequence:CCGGTTTCCGATCTGAGCTATTTAACTCGAGTTAAATAGCTCAGATCGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176917.4-1934s21c1
Sequence:CCGGAGTTTCAGCACATGGATTATTCTCGAGAATAATCCATGTGCTGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176917.4-1995s21c1
Sequence:CCGGCTGTCTTTACCTCAGCTCCTTCTCGAGAAGGAGCTGAGGTAAAGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176917.4-1114s21c1
Sequence:CCGGAGTAGCGGATGCATCACTTTACTCGAGTAAAGTGATGCATCCGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176917
METTL4 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176917.3-1145s1c1
Sequence:CCGGGCCTGCAATTTATCAGAGTTACTCGAGTAACTCTGATAAATTGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176917.3-1483s1c1
Sequence:CCGGGCAGATAAAGCGAATGCCTATCTCGAGATAGGCATTCGCTTTATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184119    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176917.3-1996s1c1
Sequence:CCGGCTGTCTTTACCTCAGCTCCTTCTCGAGAAGGAGCTGAGGTAAAGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176917.4-825s21c1
Sequence:CCGGTTTCCGATCTGAGCTATTTAACTCGAGTTAAATAGCTCAGATCGGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176917.4-1934s21c1
Sequence:CCGGAGTTTCAGCACATGGATTATTCTCGAGAATAATCCATGTGCTGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176917.4-1995s21c1
Sequence:CCGGCTGTCTTTACCTCAGCTCCTTCTCGAGAAGGAGCTGAGGTAAAGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176917.4-1114s21c1
Sequence:CCGGAGTAGCGGATGCATCACTTTACTCGAGTAAAGTGATGCATCCGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)