EMAIL THIS PAGE TO A FRIEND

METTL5

methyltransferase like 5

73 Gene Product Result for
Synonyms: HSPC133
UniProtKB ID: Q9NRN9, D3DPC9, Q9NVX1
Gene ID:
Mouse(75422) methyltransferase like 5
Rat(502632) methyltransferase like 5
sheep(101118588) methyltransferase like 5
domestic guinea pig(100736160) methyltransferase like 5
naked mole-rat(101723651) methyltransferase like 5
Zebrafish(449776) methyltransferase like 5
dog(478788) methyltransferase like 5
cow(614427) methyltransferase like 5
domestic cat(101087766) methyltransferase like 5
chicken(771367) methyltransferase like 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101471 Anti-METTL5 antibody produced in rabbit affinity isolated antibody bovine, rat, human, horse, canine, mouse, guinea pig, zebrafish, rabbit
western blot pricing
HPA038223 Anti-METTL5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2105001 Anti-METTL5, (N-terminal) antibody produced in rabbit affinity isolated antibody guinea pig, mouse, human, rabbit, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029280 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029280 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029280 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014168 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014168 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014168 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014168 Rosetta Predictions human pricing
NM_001114181 Rosetta Predictions rat pricing
NM_029280 Rosetta Predictions mouse pricing
XM_130324 Rosetta Predictions mouse pricing
XM_892172 Rosetta Predictions mouse pricing
XM_899988 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170949 predicted 587
2 SASI_Hs01_00170950 predicted 521
3 SASI_Hs01_00170951 predicted 307
4 SASI_Hs01_00170952 predicted 500
5 SASI_Hs01_00170953 predicted 463
6 SASI_Hs01_00170954 predicted 522
7 SASI_Hs01_00170955 predicted 491
8 SASI_Hs01_00170956 predicted 557
9 SASI_Hs01_00170958 predicted 598
10 SASI_Hs02_00345167 predicted 396
11 SASI_Hs01_00170957 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114181 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252203 predicted 345
2 SASI_Rn02_00252204 predicted 557
3 SASI_Rn02_00252205 predicted 410
4 SASI_Rn02_00252206 predicted 529
5 SASI_Rn02_00252207 predicted 517
6 SASI_Rn02_00252208 predicted 536
7 SASI_Rn02_00252209 predicted 439
8 SASI_Rn02_00252210 predicted 365
9 SASI_Rn02_00252211 predicted 713
10 SASI_Rn02_00252212 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029280 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335069 predicted 567
2 SASI_Mm02_00335070 predicted 595
3 SASI_Mm02_00335071 predicted 560
4 SASI_Mm02_00335072 predicted 460
5 SASI_Mm02_00335073 predicted 519
6 SASI_Mm02_00335074 predicted 398
7 SASI_Mm02_00335075 predicted 286
8 SASI_Mm02_00335076 predicted 722
9 SASI_Mm02_00335077 predicted 575
10 SASI_Mm02_00335078 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130324 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213505 predicted 412
2 SASI_Mm01_00213506 predicted 306
3 SASI_Mm01_00213507 predicted 373
4 SASI_Mm01_00213508 predicted 455
5 SASI_Mm01_00213509 predicted 291
6 SASI_Mm01_00213510 predicted 485
7 SASI_Mm01_00213511 predicted 319
8 SASI_Mm01_00213512 predicted 368
9 SASI_Mm01_00213513 predicted 302
10 SASI_Mm01_00213514 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_892172 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267006 predicted 413
2 SASI_Mm01_00267007 predicted 303
3 SASI_Mm01_00267008 predicted 368
4 SASI_Mm01_00267009 predicted 458
5 SASI_Mm01_00267010 predicted 290
6 SASI_Mm01_00267011 predicted 484
7 SASI_Mm01_00267012 predicted 321
8 SASI_Mm01_00267013 predicted 365
9 SASI_Mm01_00267014 predicted 299
10 SASI_Mm01_00267015 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899988 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272910 predicted 419
2 SASI_Mm01_00272911 predicted 298
3 SASI_Mm01_00272912 predicted 375
4 SASI_Mm01_00272913 predicted 453
5 SASI_Mm01_00272914 predicted 289
6 SASI_Mm01_00272915 predicted 484
7 SASI_Mm01_00272916 predicted 325
8 SASI_Mm01_00272917 predicted 365
9 SASI_Mm01_00272918 predicted 302
10 SASI_Mm01_00272919 predicted 415
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029280
METTL5 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029280.3-689s21c1
Sequence:CCGGATGGCAAGAACAGCAGTATATCTCGAGATATACTGCTGTTCTTGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029280.3-721s21c1
Sequence:CCGGGTCCTCAACTAGGGAACATATCTCGAGATATGTTCCCTAGTTGAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029280.3-779s21c1
Sequence:CCGGATTATTGCAGAGCTTCGATATCTCGAGATATCGAAGCTCTGCAATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029280.3-361s21c1
Sequence:CCGGCATGCTTTATACAATCCATAACTCGAGTTATGGATTGTATAAAGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029280.3-530s21c1
Sequence:CCGGGAAGAGTTTGAGCTAACAAATCTCGAGATTTGTTAGCTCAAACTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029280
METTL5 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029280.3-689s21c1
Sequence:CCGGATGGCAAGAACAGCAGTATATCTCGAGATATACTGCTGTTCTTGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029280.3-721s21c1
Sequence:CCGGGTCCTCAACTAGGGAACATATCTCGAGATATGTTCCCTAGTTGAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029280.3-779s21c1
Sequence:CCGGATTATTGCAGAGCTTCGATATCTCGAGATATCGAAGCTCTGCAATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029280.3-361s21c1
Sequence:CCGGCATGCTTTATACAATCCATAACTCGAGTTATGGATTGTATAAAGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029280.3-530s21c1
Sequence:CCGGGAAGAGTTTGAGCTAACAAATCTCGAGATTTGTTAGCTCAAACTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029280
METTL5 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029280.3-689s21c1
Sequence:CCGGATGGCAAGAACAGCAGTATATCTCGAGATATACTGCTGTTCTTGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029280.3-721s21c1
Sequence:CCGGGTCCTCAACTAGGGAACATATCTCGAGATATGTTCCCTAGTTGAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029280.3-779s21c1
Sequence:CCGGATTATTGCAGAGCTTCGATATCTCGAGATATCGAAGCTCTGCAATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029280.3-361s21c1
Sequence:CCGGCATGCTTTATACAATCCATAACTCGAGTTATGGATTGTATAAAGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029280.3-530s21c1
Sequence:CCGGGAAGAGTTTGAGCTAACAAATCTCGAGATTTGTTAGCTCAAACTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014168
VALIDATED
METTL5 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014168.2-564s21c1
Sequence:CCGGATGTGATGTGTGCTTATTATCCTCGAGGATAATAAGCACACATCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014168.2-778s21c1
Sequence:CCGGATTATAGCAGAACTTCGATATCTCGAGATATCGAAGTTCTGCTATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014168.2-350s21c1
Sequence:CCGGTTGCAGCATGTATGCTCTATACTCGAGTATAGAGCATACATGCTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014168.2-600s21c1
Sequence:CCGGGTCATTCGATACAGTAATTATCTCGAGATAATTACTGTATCGAATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167640    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014168.1-533s1c1
Sequence:CCGGGCAGTATATTCCTTACACAAACTCGAGTTTGTGTAAGGAATATACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014168.1-211s1c1
Sequence:CCGGCCATAACACTTATGATGACATCTCGAGATGTCATCATAAGTGTTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014168.1-332s1c1
Sequence:CCGGGAAGACGCATTGGAAATATTTCTCGAGAAATATTTCCAATGCGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014168
VALIDATED
METTL5 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014168.2-564s21c1
Sequence:CCGGATGTGATGTGTGCTTATTATCCTCGAGGATAATAAGCACACATCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014168.2-778s21c1
Sequence:CCGGATTATAGCAGAACTTCGATATCTCGAGATATCGAAGTTCTGCTATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014168.2-350s21c1
Sequence:CCGGTTGCAGCATGTATGCTCTATACTCGAGTATAGAGCATACATGCTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014168.2-600s21c1
Sequence:CCGGGTCATTCGATACAGTAATTATCTCGAGATAATTACTGTATCGAATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167640    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014168.1-533s1c1
Sequence:CCGGGCAGTATATTCCTTACACAAACTCGAGTTTGTGTAAGGAATATACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014168.1-211s1c1
Sequence:CCGGCCATAACACTTATGATGACATCTCGAGATGTCATCATAAGTGTTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014168.1-332s1c1
Sequence:CCGGGAAGACGCATTGGAAATATTTCTCGAGAAATATTTCCAATGCGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014168
VALIDATED
METTL5 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014168.2-564s21c1
Sequence:CCGGATGTGATGTGTGCTTATTATCCTCGAGGATAATAAGCACACATCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014168.2-778s21c1
Sequence:CCGGATTATAGCAGAACTTCGATATCTCGAGATATCGAAGTTCTGCTATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014168.2-350s21c1
Sequence:CCGGTTGCAGCATGTATGCTCTATACTCGAGTATAGAGCATACATGCTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014168.2-600s21c1
Sequence:CCGGGTCATTCGATACAGTAATTATCTCGAGATAATTACTGTATCGAATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167640    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014168.1-533s1c1
Sequence:CCGGGCAGTATATTCCTTACACAAACTCGAGTTTGTGTAAGGAATATACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014168.1-211s1c1
Sequence:CCGGCCATAACACTTATGATGACATCTCGAGATGTCATCATAAGTGTTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014168.1-332s1c1
Sequence:CCGGGAAGACGCATTGGAAATATTTCTCGAGAAATATTTCCAATGCGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)