EMAIL THIS PAGE TO A FRIEND

METTL6

methyltransferase like 6

54 Gene Product Result for
UniProtKB ID: Q8TCB7, Q96LU4
Gene ID:
Mouse(67011) methyltransferase like 6
Rat(290564) methyltransferase like 6
Zebrafish(791999) methyltransferase like 6
cow(535332) methyltransferase like 6
domestic cat(101092638) methyltransferase like 6
dog(477061) methyltransferase like 6
chicken(420681) methyltransferase like 6
naked mole-rat(101712579) methyltransferase like 6
domestic guinea pig(100730421) methyltransferase like 6
sheep(101118750) methyltransferase like 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025907 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025907 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025907 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152396 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152396 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152396 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152396 Rosetta Predictions human pricing
NM_001007623 Rosetta Predictions rat pricing
NM_025907 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152396 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148576 predicted 331
2 SASI_Hs01_00148577 predicted 747
3 SASI_Hs02_00366072 predicted 807
4 SASI_Hs01_00148579 predicted 741
5 SASI_Hs01_00148580 predicted 642
6 SASI_Hs01_00148582 predicted 286
7 SASI_Hs01_00148583 predicted 645
8 SASI_Hs02_00366073 predicted 893
9 SASI_Hs02_00366074 predicted 655
10 SASI_Hs02_00366075 predicted 801
11 SASI_Hs01_00148575 predicted 423
12 SASI_Hs01_00148578 predicted 401
13 SASI_Hs01_00148581 predicted 673
14 SASI_Hs01_00148584 predicted 723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007623 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054860 predicted 733
2 SASI_Rn01_00054861 predicted 436
3 SASI_Rn01_00054863 predicted 925
4 SASI_Rn02_00198711 predicted 925
5 SASI_Rn01_00054864 predicted 654
6 SASI_Rn01_00054865 predicted 754
7 SASI_Rn01_00054866 predicted 900
8 SASI_Rn01_00054867 predicted 535
9 SASI_Rn02_00198712 predicted 920
10 SASI_Rn02_00198713 predicted 964
11 SASI_Rn01_00054858 predicted 785
12 SASI_Rn01_00054859 predicted 321
13 SASI_Rn01_00054862 predicted 807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025907 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085751 predicted 780
2 SASI_Mm01_00085752 predicted 1438
3 SASI_Mm01_00085754 predicted 767
4 SASI_Mm01_00085755 predicted 707
5 SASI_Mm01_00085756 predicted 709
6 SASI_Mm01_00085757 predicted 854
7 SASI_Mm01_00085758 predicted 1448
8 SASI_Mm01_00085759 predicted 1393
9 SASI_Mm01_00085760 predicted 409
10 SASI_Mm02_00329261 predicted 405
11 SASI_Mm01_00085753 predicted 250
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025907
VALIDATED
METTL6 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 6
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025907.3-725s21c1
Sequence:CCGGGCCTTGTCTTACTAAACGTGTCTCGAGACACGTTTAGTAAGACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025907.3-1046s21c1
Sequence:CCGGCCAGTGACTCTGCTTCACTTTCTCGAGAAAGTGAAGCAGAGTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097554    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025907.2-1316s1c1
Sequence:CCGGGCAGCTCACTTCCATCAGTAACTCGAGTTACTGATGGAAGTGAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025907.2-726s1c1
Sequence:CCGGGCCTTGTCTTACTAAACGTGTCTCGAGACACGTTTAGTAAGACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025907.2-727s1c1
Sequence:CCGGCCTTGTCTTACTAAACGTGTACTCGAGTACACGTTTAGTAAGACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025907.3-1397s21c1
Sequence:CCGGTGCAGGCAAACACCCAAATTACTCGAGTAATTTGGGTGTTTGCCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025907.2-563s1c1
Sequence:CCGGGCAGTTGACTACGTGAAGCAACTCGAGTTGCTTCACGTAGTCAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025907.2-1047s1c1
Sequence:CCGGCCAGTGACTCTGCTTCACTTTCTCGAGAAAGTGAAGCAGAGTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025907.3-861s21c1
Sequence:CCGGAGATGGAACCAGATCGTATTTCTCGAGAAATACGATCTGGTTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025907.3-801s21c1
Sequence:CCGGTCACGCCATGCTTAGATTTAACTCGAGTTAAATCTAAGCATGGCGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025907.3-1434s21c1
Sequence:CCGGAGGTTTGGCAATTTGAGTTTACTCGAGTAAACTCAAATTGCCAAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025907.3-952s21c1
Sequence:CCGGTTTCGAGAGACAGTGAATAAACTCGAGTTTATTCACTGTCTCTCGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025907
VALIDATED
METTL6 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 6
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025907.3-725s21c1
Sequence:CCGGGCCTTGTCTTACTAAACGTGTCTCGAGACACGTTTAGTAAGACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025907.3-1046s21c1
Sequence:CCGGCCAGTGACTCTGCTTCACTTTCTCGAGAAAGTGAAGCAGAGTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097554    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025907.2-1316s1c1
Sequence:CCGGGCAGCTCACTTCCATCAGTAACTCGAGTTACTGATGGAAGTGAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025907.2-726s1c1
Sequence:CCGGGCCTTGTCTTACTAAACGTGTCTCGAGACACGTTTAGTAAGACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025907.2-727s1c1
Sequence:CCGGCCTTGTCTTACTAAACGTGTACTCGAGTACACGTTTAGTAAGACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025907.3-1397s21c1
Sequence:CCGGTGCAGGCAAACACCCAAATTACTCGAGTAATTTGGGTGTTTGCCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025907.2-563s1c1
Sequence:CCGGGCAGTTGACTACGTGAAGCAACTCGAGTTGCTTCACGTAGTCAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025907.2-1047s1c1
Sequence:CCGGCCAGTGACTCTGCTTCACTTTCTCGAGAAAGTGAAGCAGAGTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025907.3-861s21c1
Sequence:CCGGAGATGGAACCAGATCGTATTTCTCGAGAAATACGATCTGGTTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025907.3-801s21c1
Sequence:CCGGTCACGCCATGCTTAGATTTAACTCGAGTTAAATCTAAGCATGGCGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025907.3-1434s21c1
Sequence:CCGGAGGTTTGGCAATTTGAGTTTACTCGAGTAAACTCAAATTGCCAAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025907.3-952s21c1
Sequence:CCGGTTTCGAGAGACAGTGAATAAACTCGAGTTTATTCACTGTCTCTCGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025907
VALIDATED
METTL6 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 6
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025907.3-725s21c1
Sequence:CCGGGCCTTGTCTTACTAAACGTGTCTCGAGACACGTTTAGTAAGACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025907.3-1046s21c1
Sequence:CCGGCCAGTGACTCTGCTTCACTTTCTCGAGAAAGTGAAGCAGAGTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097554    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025907.2-1316s1c1
Sequence:CCGGGCAGCTCACTTCCATCAGTAACTCGAGTTACTGATGGAAGTGAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025907.2-726s1c1
Sequence:CCGGGCCTTGTCTTACTAAACGTGTCTCGAGACACGTTTAGTAAGACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025907.2-727s1c1
Sequence:CCGGCCTTGTCTTACTAAACGTGTACTCGAGTACACGTTTAGTAAGACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025907.3-1397s21c1
Sequence:CCGGTGCAGGCAAACACCCAAATTACTCGAGTAATTTGGGTGTTTGCCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025907.2-563s1c1
Sequence:CCGGGCAGTTGACTACGTGAAGCAACTCGAGTTGCTTCACGTAGTCAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025907.2-1047s1c1
Sequence:CCGGCCAGTGACTCTGCTTCACTTTCTCGAGAAAGTGAAGCAGAGTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025907.3-861s21c1
Sequence:CCGGAGATGGAACCAGATCGTATTTCTCGAGAAATACGATCTGGTTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025907.3-801s21c1
Sequence:CCGGTCACGCCATGCTTAGATTTAACTCGAGTTAAATCTAAGCATGGCGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025907.3-1434s21c1
Sequence:CCGGAGGTTTGGCAATTTGAGTTTACTCGAGTAAACTCAAATTGCCAAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025907.3-952s21c1
Sequence:CCGGTTTCGAGAGACAGTGAATAAACTCGAGTTTATTCACTGTCTCTCGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152396
VALIDATED
METTL6 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 6
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152396.2-947s21c1
Sequence:CCGGTCTTTATGGACACAGGTTATGCTCGAGCATAACCTGTGTCCATAAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_152396.1-258s1c1
Sequence:CCGGGCAAGGATTCTCACCTCTGAACTCGAGTTCAGAGGTGAGAATCCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152396.2-592s21c1
Sequence:CCGGTCTCCAAGAGCCATTGAATATCTCGAGATATTCAATGGCTCTTGGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152396.2-900s21c1
Sequence:CCGGAGATGGGACCAGATCATATTTCTCGAGAAATATGATCTGGTCCCATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_152396.1-434s1c1
Sequence:CCGGGCTAAGATCATGTAGAGAGTTCTCGAGAACTCTCTACATGATCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_152396.1-528s1c1
Sequence:CCGGGATCCGAATATCTTTGCCTATCTCGAGATAGGCAAAGATATTCGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_152396.1-645s1c1
Sequence:CCGGGATGATCTTCTGGATCATGTACTCGAGTACATGATCCAGAAGATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_152396.1-302s1c1
Sequence:CCGGCCAAACTTTGGTGTCTGATTTCTCGAGAAATCAGACACCAAAGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_152396.1-603s1c1
Sequence:CCGGGATACAGAAAGATGCAAGGTACTCGAGTACCTTGCATCTTTCTGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_152396.1-300s1c1
Sequence:CCGGGACCAAACTTTGGTGTCTGATCTCGAGATCAGACACCAAAGTTTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152396.1-797s1c1
Sequence:CCGGCGGACTGTATGATCATGCCATCTCGAGATGGCATGATCATACAGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_152396.1-418s1c1
Sequence:CCGGCCAGAGAGTTTGAGGAGCTAACTCGAGTTAGCTCCTCAAACTCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152396.2-1114s21c1
Sequence:CCGGCCTTTCATGAGGTTGGCATTTCTCGAGAAATGCCAACCTCATGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152396
VALIDATED
METTL6 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 6
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152396.2-947s21c1
Sequence:CCGGTCTTTATGGACACAGGTTATGCTCGAGCATAACCTGTGTCCATAAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_152396.1-258s1c1
Sequence:CCGGGCAAGGATTCTCACCTCTGAACTCGAGTTCAGAGGTGAGAATCCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152396.2-592s21c1
Sequence:CCGGTCTCCAAGAGCCATTGAATATCTCGAGATATTCAATGGCTCTTGGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152396.2-900s21c1
Sequence:CCGGAGATGGGACCAGATCATATTTCTCGAGAAATATGATCTGGTCCCATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_152396.1-434s1c1
Sequence:CCGGGCTAAGATCATGTAGAGAGTTCTCGAGAACTCTCTACATGATCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_152396.1-528s1c1
Sequence:CCGGGATCCGAATATCTTTGCCTATCTCGAGATAGGCAAAGATATTCGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_152396.1-645s1c1
Sequence:CCGGGATGATCTTCTGGATCATGTACTCGAGTACATGATCCAGAAGATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_152396.1-302s1c1
Sequence:CCGGCCAAACTTTGGTGTCTGATTTCTCGAGAAATCAGACACCAAAGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_152396.1-603s1c1
Sequence:CCGGGATACAGAAAGATGCAAGGTACTCGAGTACCTTGCATCTTTCTGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_152396.1-300s1c1
Sequence:CCGGGACCAAACTTTGGTGTCTGATCTCGAGATCAGACACCAAAGTTTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152396.1-797s1c1
Sequence:CCGGCGGACTGTATGATCATGCCATCTCGAGATGGCATGATCATACAGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_152396.1-418s1c1
Sequence:CCGGCCAGAGAGTTTGAGGAGCTAACTCGAGTTAGCTCCTCAAACTCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152396.2-1114s21c1
Sequence:CCGGCCTTTCATGAGGTTGGCATTTCTCGAGAAATGCCAACCTCATGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152396
VALIDATED
METTL6 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 6
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152396.2-947s21c1
Sequence:CCGGTCTTTATGGACACAGGTTATGCTCGAGCATAACCTGTGTCCATAAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_152396.1-258s1c1
Sequence:CCGGGCAAGGATTCTCACCTCTGAACTCGAGTTCAGAGGTGAGAATCCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152396.2-592s21c1
Sequence:CCGGTCTCCAAGAGCCATTGAATATCTCGAGATATTCAATGGCTCTTGGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152396.2-900s21c1
Sequence:CCGGAGATGGGACCAGATCATATTTCTCGAGAAATATGATCTGGTCCCATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_152396.1-434s1c1
Sequence:CCGGGCTAAGATCATGTAGAGAGTTCTCGAGAACTCTCTACATGATCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_152396.1-528s1c1
Sequence:CCGGGATCCGAATATCTTTGCCTATCTCGAGATAGGCAAAGATATTCGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_152396.1-645s1c1
Sequence:CCGGGATGATCTTCTGGATCATGTACTCGAGTACATGATCCAGAAGATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_152396.1-302s1c1
Sequence:CCGGCCAAACTTTGGTGTCTGATTTCTCGAGAAATCAGACACCAAAGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_152396.1-603s1c1
Sequence:CCGGGATACAGAAAGATGCAAGGTACTCGAGTACCTTGCATCTTTCTGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_152396.1-300s1c1
Sequence:CCGGGACCAAACTTTGGTGTCTGATCTCGAGATCAGACACCAAAGTTTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152396.1-797s1c1
Sequence:CCGGCGGACTGTATGATCATGCCATCTCGAGATGGCATGATCATACAGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_152396.1-418s1c1
Sequence:CCGGCCAGAGAGTTTGAGGAGCTAACTCGAGTTAGCTCCTCAAACTCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152396.2-1114s21c1
Sequence:CCGGCCTTTCATGAGGTTGGCATTTCTCGAGAAATGCCAACCTCATGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)