EMAIL THIS PAGE TO A FRIEND

METTL7B

methyltransferase like 7B

56 Gene Product Result for
Synonyms: ALDI
UniProtKB ID: Q6UX53, A8K247, Q8WUI1
Gene ID:
Mouse(71664) methyltransferase like 7B
Rat(366792) methyltransferase like 7B
dog(474390) methyltransferase like 7B
cow(506952) methyltransferase like 7B
domestic cat(101089531) methyltransferase like 7B
sheep(101115696) methyltransferase like 7B
naked mole-rat(101703440) methyltransferase like 7B
domestic guinea pig(100717217) methyltransferase like 7B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027853 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027853 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027853 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152637 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152637 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152637 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008171 MISSION® esiRNA esiRNA targeting human METTL7B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152637 Rosetta Predictions human pricing
NM_001024276 Rosetta Predictions rat pricing
NM_027853 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152637 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366518 predicted 755
2 SASI_Hs01_00050871 predicted 534
3 SASI_Hs01_00050875 predicted 400
4 SASI_Hs01_00050879 predicted 845
5 SASI_Hs02_00366519 predicted 1044
6 SASI_Hs02_00366520 predicted 758
7 SASI_Hs02_00366521 predicted 514
8 SASI_Hs02_00366522 predicted 1166
9 SASI_Hs02_00366523 predicted 1139
10 SASI_Hs02_00366524 predicted 412
11 SASI_Hs01_00050870 predicted 393
12 SASI_Hs01_00050872 predicted 842
13 SASI_Hs01_00050873 predicted 1186
14 SASI_Hs01_00050874 predicted 954
15 SASI_Hs01_00050876 predicted 1118
16 SASI_Hs01_00050877 predicted 512
17 SASI_Hs01_00050878 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024276 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078233 predicted 417
2 SASI_Rn01_00078234 predicted 349
3 SASI_Rn01_00078235 predicted 366
4 SASI_Rn01_00078236 predicted 262
5 SASI_Rn01_00078237 predicted 598
6 SASI_Rn01_00078238 predicted 590
7 SASI_Rn01_00078242 predicted 699
8 SASI_Rn02_00202452 predicted 671
9 SASI_Rn02_00202453 predicted 656
10 SASI_Rn02_00202454 predicted 616
11 SASI_Rn01_00078239 predicted 646
12 SASI_Rn01_00078240 predicted 524
13 SASI_Rn01_00078241 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027853 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180355 predicted 218
2 SASI_Mm01_00180356 predicted 203
3 SASI_Mm01_00180357 predicted 393
4 SASI_Mm01_00180358 predicted 623
5 SASI_Mm01_00180359 predicted 290
6 SASI_Mm02_00332808 predicted 319
7 SASI_Mm01_00180360 predicted 416
8 SASI_Mm01_00180361 predicted 629
9 SASI_Mm01_00180362 predicted 670
10 SASI_Mm01_00180363 predicted 914
11 SASI_Mm01_00180364 predicted 555
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027853
METTL7B MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 7B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027853.2-669s21c1
Sequence:CCGGGAGACCTGGAAAGACATTGAGCTCGAGCTCAATGTCTTTCCAGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027853.2-476s21c1
Sequence:CCGGCTGTACCCTGGTGCTATGTTCCTCGAGGAACATAGCACCAGGGTACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097534    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027853.1-1005s1c1
Sequence:CCGGCTCTCTCTTGTCCCTATGGTACTCGAGTACCATAGGGACAAGAGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027853.1-631s1c1
Sequence:CCGGACCTGGAAACACATCGGAGATCTCGAGATCTCCGATGTGTTTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027853.1-217s1c1
Sequence:CCGGCGGGAACTATTTAGCCAGATACTCGAGTATCTGGCTAAATAGTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027853.1-160s1c1
Sequence:CCGGCCTTACTTCATGGCCATGCTACTCGAGTAGCATGGCCATGAAGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027853.1-424s1c1
Sequence:CCGGGCTTACGGAGAGAACATGAAACTCGAGTTTCATGTTCTCTCCGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027853
METTL7B MISSION shRNA shRNA Plasmid DNA
methyltransferase like 7B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027853.2-669s21c1
Sequence:CCGGGAGACCTGGAAAGACATTGAGCTCGAGCTCAATGTCTTTCCAGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027853.2-476s21c1
Sequence:CCGGCTGTACCCTGGTGCTATGTTCCTCGAGGAACATAGCACCAGGGTACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097534    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027853.1-1005s1c1
Sequence:CCGGCTCTCTCTTGTCCCTATGGTACTCGAGTACCATAGGGACAAGAGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027853.1-631s1c1
Sequence:CCGGACCTGGAAACACATCGGAGATCTCGAGATCTCCGATGTGTTTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027853.1-217s1c1
Sequence:CCGGCGGGAACTATTTAGCCAGATACTCGAGTATCTGGCTAAATAGTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027853.1-160s1c1
Sequence:CCGGCCTTACTTCATGGCCATGCTACTCGAGTAGCATGGCCATGAAGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027853.1-424s1c1
Sequence:CCGGGCTTACGGAGAGAACATGAAACTCGAGTTTCATGTTCTCTCCGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027853
METTL7B MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 7B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027853.2-669s21c1
Sequence:CCGGGAGACCTGGAAAGACATTGAGCTCGAGCTCAATGTCTTTCCAGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027853.2-476s21c1
Sequence:CCGGCTGTACCCTGGTGCTATGTTCCTCGAGGAACATAGCACCAGGGTACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097534    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027853.1-1005s1c1
Sequence:CCGGCTCTCTCTTGTCCCTATGGTACTCGAGTACCATAGGGACAAGAGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027853.1-631s1c1
Sequence:CCGGACCTGGAAACACATCGGAGATCTCGAGATCTCCGATGTGTTTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027853.1-217s1c1
Sequence:CCGGCGGGAACTATTTAGCCAGATACTCGAGTATCTGGCTAAATAGTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027853.1-160s1c1
Sequence:CCGGCCTTACTTCATGGCCATGCTACTCGAGTAGCATGGCCATGAAGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027853.1-424s1c1
Sequence:CCGGGCTTACGGAGAGAACATGAAACTCGAGTTTCATGTTCTCTCCGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152637
VALIDATED
METTL7B MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 7B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_152637.2-952s21c1
Sequence:CCGGCAAGCTCCAAGGCACTCATTTCTCGAGAAATGAGTGCCTTGGAGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152637.2-546s21c1
Sequence:CCGGGAGAACAGGCACCTCCAATATCTCGAGATATTGGAGGTGCCTGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152637.2-924s21c1
Sequence:CCGGATGGGAAAGGCTGTCAAATAACTCGAGTTATTTGACAGCCTTTCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_152637.2-378s21c1
Sequence:CCGGGAGCTCTTCAGCCAGATAAAGCTCGAGCTTTATCTGGCTGAAGAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_152637.2-848s21c1
Sequence:CCGGGAACGCCCAGTTCTCCGAAATCTCGAGATTTCGGAGAACTGGGCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152637.1-361s1c1
Sequence:CCGGCGGAGCCAACTTTCAGTTCTACTCGAGTAGAACTGAAAGTTGGCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152637.1-763s1c1
Sequence:CCGGCCAGTTCTCCGAAATCCAAATCTCGAGATTTGGATTTCGGAGAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152637.1-1011s1c1
Sequence:CCGGCAGGGCAATCTCTAACTTCAACTCGAGTTGAAGTTAGAGATTGCCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152637.1-772s1c1
Sequence:CCGGCGAAATCCAAATGGAACGACACTCGAGTGTCGTTCCATTTGGATTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152637
VALIDATED
METTL7B MISSION shRNA shRNA Plasmid DNA
methyltransferase like 7B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_152637.2-952s21c1
Sequence:CCGGCAAGCTCCAAGGCACTCATTTCTCGAGAAATGAGTGCCTTGGAGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152637.2-546s21c1
Sequence:CCGGGAGAACAGGCACCTCCAATATCTCGAGATATTGGAGGTGCCTGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152637.2-924s21c1
Sequence:CCGGATGGGAAAGGCTGTCAAATAACTCGAGTTATTTGACAGCCTTTCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_152637.2-378s21c1
Sequence:CCGGGAGCTCTTCAGCCAGATAAAGCTCGAGCTTTATCTGGCTGAAGAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_152637.2-848s21c1
Sequence:CCGGGAACGCCCAGTTCTCCGAAATCTCGAGATTTCGGAGAACTGGGCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152637.1-361s1c1
Sequence:CCGGCGGAGCCAACTTTCAGTTCTACTCGAGTAGAACTGAAAGTTGGCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152637.1-763s1c1
Sequence:CCGGCCAGTTCTCCGAAATCCAAATCTCGAGATTTGGATTTCGGAGAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152637.1-1011s1c1
Sequence:CCGGCAGGGCAATCTCTAACTTCAACTCGAGTTGAAGTTAGAGATTGCCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152637.1-772s1c1
Sequence:CCGGCGAAATCCAAATGGAACGACACTCGAGTGTCGTTCCATTTGGATTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152637
VALIDATED
METTL7B MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 7B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_152637.2-952s21c1
Sequence:CCGGCAAGCTCCAAGGCACTCATTTCTCGAGAAATGAGTGCCTTGGAGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152637.2-546s21c1
Sequence:CCGGGAGAACAGGCACCTCCAATATCTCGAGATATTGGAGGTGCCTGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152637.2-924s21c1
Sequence:CCGGATGGGAAAGGCTGTCAAATAACTCGAGTTATTTGACAGCCTTTCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_152637.2-378s21c1
Sequence:CCGGGAGCTCTTCAGCCAGATAAAGCTCGAGCTTTATCTGGCTGAAGAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_152637.2-848s21c1
Sequence:CCGGGAACGCCCAGTTCTCCGAAATCTCGAGATTTCGGAGAACTGGGCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152637.1-361s1c1
Sequence:CCGGCGGAGCCAACTTTCAGTTCTACTCGAGTAGAACTGAAAGTTGGCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152637.1-763s1c1
Sequence:CCGGCCAGTTCTCCGAAATCCAAATCTCGAGATTTGGATTTCGGAGAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152637.1-1011s1c1
Sequence:CCGGCAGGGCAATCTCTAACTTCAACTCGAGTTGAAGTTAGAGATTGCCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152637.1-772s1c1
Sequence:CCGGCGAAATCCAAATGGAACGACACTCGAGTGTCGTTCCATTTGGATTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)