EMAIL THIS PAGE TO A FRIEND

METTL8

methyltransferase like 8

88 Gene Product Result for
Synonyms: TIP
UniProtKB ID: Q9H825, Q53TM9, Q53TQ0
Gene ID:
Mouse(228019) methyltransferase like 8
Rat(502633) methyltransferase like 8
domestic guinea pig(100725342) methyltransferase like 8
naked mole-rat(101699266) methyltransferase like 8
sheep(101116455) methyltransferase like 8
Zebrafish(100148927) methyltransferase like 8
cow(506947) methyltransferase like 8
Horse(100063530) methyltransferase like 8
domestic cat(101089381) methyltransferase like 8
dog(488397) methyltransferase like 8
chicken(424154) methyltransferase like 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA035421 Anti-METTL8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024770 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024770 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024770 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145524 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145524 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145524 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024770 Rosetta Predictions human pricing
XM_001060093 Rosetta Predictions rat pricing
XM_578127 Rosetta Predictions rat pricing
NM_001110512 Rosetta Predictions mouse pricing
NM_145524 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024770 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357279 predicted 1047
2 SASI_Hs01_00059804 predicted 1297
3 SASI_Hs01_00059805 predicted 1397
4 SASI_Hs02_00357280 predicted 1059
5 SASI_Hs01_00059806 predicted 791
6 SASI_Hs02_00357281 predicted 1040
7 SASI_Hs01_00059808 predicted 1317
8 SASI_Hs02_00357282 predicted 1305
9 SASI_Hs01_00059811 predicted 802
10 SASI_Hs01_00059812 predicted 1343
11 SASI_Hs01_00059807 predicted 1370
12 SASI_Hs01_00059809 predicted 836
13 SASI_Hs01_00059810 predicted 1248
14 SASI_Hs01_00059813 predicted 926
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060093 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295381 predicted 734
2 SASI_Rn02_00295382 predicted 435
3 SASI_Rn02_00295383 predicted 257
4 SASI_Rn02_00295384 predicted 469
5 SASI_Rn02_00295385 predicted 573
6 SASI_Rn02_00295386 predicted 734
7 SASI_Rn02_00295387 predicted 272
8 SASI_Rn02_00295388 predicted 724
9 SASI_Rn02_00295389 predicted 559
10 SASI_Rn02_00295390 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578127 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00407609 predicted 514
2 SASI_Rn02_00407610 predicted 505
3 SASI_Rn02_00407611 predicted 809
4 SASI_Rn02_00407612 predicted 598
5 SASI_Rn02_00407613 predicted 907
6 SASI_Rn02_00407614 predicted 354
7 SASI_Rn02_00407615 predicted 440
8 SASI_Rn02_00407616 predicted 1064
9 SASI_Rn02_00407617 predicted 540
10 SASI_Rn02_00407618 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110512 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305618 predicted 1175
2 SASI_Mm02_00305619 predicted 1177
3 SASI_Mm02_00305620 predicted 1187
4 SASI_Mm02_00305621 predicted 973
5 SASI_Mm02_00305622 predicted 499
6 SASI_Mm02_00305623 predicted 659
7 SASI_Mm02_00305624 predicted 676
8 SASI_Mm02_00305625 predicted 684
9 SASI_Mm02_00305626 predicted 668
10 SASI_Mm02_00305627 predicted 1096
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145524 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340998 predicted 1633
2 SASI_Mm02_00340999 predicted 1644
3 SASI_Mm02_00341000 predicted 1645
4 SASI_Mm02_00341001 predicted 1431
5 SASI_Mm01_00161733 predicted 962
6 SASI_Mm01_00161734 predicted 1123
7 SASI_Mm02_00341002 predicted 1142
8 SASI_Mm02_00341003 predicted 1149
9 SASI_Mm02_00341004 predicted 1136
10 SASI_Mm02_00341005 predicted 1562
11 SASI_Mm01_00161730 predicted 481
12 SASI_Mm01_00161731 predicted 764
13 SASI_Mm01_00161732 predicted 501
14 SASI_Mm01_00161735 predicted 532
15 SASI_Mm01_00161736 predicted 797
16 SASI_Mm01_00161737 predicted 425
17 SASI_Mm01_00161738 predicted 1066
18 SASI_Mm01_00161739 predicted 526
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024770
VALIDATED
METTL8 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024770.1-463s1c1
Sequence:CCGGCTAGTAAATACTGGGACACATCTCGAGATGTGTCCCAGTATTTACTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024770.1-530s1c1
Sequence:CCGGGTTGAGGGAATTTCCTGAAATCTCGAGATTTCAGGAAATTCCCTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024770.1-616s1c1
Sequence:CCGGGTGCTACAAATCGTTTCTCAACTCGAGTTGAGAAACGATTTGTAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024770.1-582s1c1
Sequence:CCGGGCGAGAGAATCATCATGGGATCTCGAGATCCCATGATGATTCTCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024770.1-512s1c1
Sequence:CCGGCAAGGATCGTAATTGGCTGTTCTCGAGAACAGCCAATTACGATCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_024770.3-1231s21c1
Sequence:CCGGGATCGCCGCTTACAAGTTAATCTCGAGATTAACTTGTAAGCGGCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_024770.3-621s21c1
Sequence:CCGGTGGTTCTTCAGAAGGTCAAAGCTCGAGCTTTGACCTTCTGAAGAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_024770.3-4971s21c1
Sequence:CCGGCTCCTTGTGTCTCCGTTTAAACTCGAGTTTAAACGGAGACACAAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_024770.3-1016s21c1
Sequence:CCGGTAAACCGACTGTCCAAGTTACCTCGAGGTAACTTGGACAGTCGGTTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_024770.3-1065s21c1
Sequence:CCGGAGACTATGGAAGATATGATAACTCGAGTTATCATATCTTCCATAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024770
VALIDATED
METTL8 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024770.1-463s1c1
Sequence:CCGGCTAGTAAATACTGGGACACATCTCGAGATGTGTCCCAGTATTTACTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024770.1-530s1c1
Sequence:CCGGGTTGAGGGAATTTCCTGAAATCTCGAGATTTCAGGAAATTCCCTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024770.1-616s1c1
Sequence:CCGGGTGCTACAAATCGTTTCTCAACTCGAGTTGAGAAACGATTTGTAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024770.1-582s1c1
Sequence:CCGGGCGAGAGAATCATCATGGGATCTCGAGATCCCATGATGATTCTCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024770.1-512s1c1
Sequence:CCGGCAAGGATCGTAATTGGCTGTTCTCGAGAACAGCCAATTACGATCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_024770.3-1231s21c1
Sequence:CCGGGATCGCCGCTTACAAGTTAATCTCGAGATTAACTTGTAAGCGGCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_024770.3-621s21c1
Sequence:CCGGTGGTTCTTCAGAAGGTCAAAGCTCGAGCTTTGACCTTCTGAAGAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_024770.3-4971s21c1
Sequence:CCGGCTCCTTGTGTCTCCGTTTAAACTCGAGTTTAAACGGAGACACAAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_024770.3-1016s21c1
Sequence:CCGGTAAACCGACTGTCCAAGTTACCTCGAGGTAACTTGGACAGTCGGTTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_024770.3-1065s21c1
Sequence:CCGGAGACTATGGAAGATATGATAACTCGAGTTATCATATCTTCCATAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024770
VALIDATED
METTL8 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024770.1-463s1c1
Sequence:CCGGCTAGTAAATACTGGGACACATCTCGAGATGTGTCCCAGTATTTACTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024770.1-530s1c1
Sequence:CCGGGTTGAGGGAATTTCCTGAAATCTCGAGATTTCAGGAAATTCCCTCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024770.1-616s1c1
Sequence:CCGGGTGCTACAAATCGTTTCTCAACTCGAGTTGAGAAACGATTTGTAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024770.1-582s1c1
Sequence:CCGGGCGAGAGAATCATCATGGGATCTCGAGATCCCATGATGATTCTCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024770.1-512s1c1
Sequence:CCGGCAAGGATCGTAATTGGCTGTTCTCGAGAACAGCCAATTACGATCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_024770.3-1231s21c1
Sequence:CCGGGATCGCCGCTTACAAGTTAATCTCGAGATTAACTTGTAAGCGGCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_024770.3-621s21c1
Sequence:CCGGTGGTTCTTCAGAAGGTCAAAGCTCGAGCTTTGACCTTCTGAAGAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_024770.3-4971s21c1
Sequence:CCGGCTCCTTGTGTCTCCGTTTAAACTCGAGTTTAAACGGAGACACAAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_024770.3-1016s21c1
Sequence:CCGGTAAACCGACTGTCCAAGTTACCTCGAGGTAACTTGGACAGTCGGTTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_024770.3-1065s21c1
Sequence:CCGGAGACTATGGAAGATATGATAACTCGAGTTATCATATCTTCCATAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145524
VALIDATED
METTL8 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 8
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145524.1-916s1c1
Sequence:CCGGCGACGGCTTAGCCTACCCTTTCTCGAGAAAGGGTAGGCTAAGCCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145524.1-448s1c1
Sequence:CCGGCCAGACCCATAAGAATAAGTTCTCGAGAACTTATTCTTATGGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145524.1-420s1c1
Sequence:CCGGACGCTAACAAATACTGGGATACTCGAGTATCCCAGTATTTGTTAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145524.1-503s1c1
Sequence:CCGGCCTGAAATCCTTCCTGTTAATCTCGAGATTAACAGGAAGGATTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145524.1-1483s1c1
Sequence:CCGGCCGAACTATGTGTCATGTTAACTCGAGTTAACATGACACATAGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145524.3-995s21c1
Sequence:CCGGCGACGGCTTAGCCTACCCTTTCTCGAGAAAGGGTAGGCTAAGCCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145524.3-582s21c1
Sequence:CCGGCCTGAAATCCTTCCTGTTAATCTCGAGATTAACAGGAAGGATTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145524.3-527s21c1
Sequence:CCGGCCAGACCCATAAGAATAAGTTCTCGAGAACTTATTCTTATGGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332231    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145524.3-1436s21c1
Sequence:CCGGCCGAACTATGTGTCATGTTAACTCGAGTTAACATGACACATAGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145524
VALIDATED
METTL8 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 8
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145524.1-916s1c1
Sequence:CCGGCGACGGCTTAGCCTACCCTTTCTCGAGAAAGGGTAGGCTAAGCCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145524.1-448s1c1
Sequence:CCGGCCAGACCCATAAGAATAAGTTCTCGAGAACTTATTCTTATGGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145524.1-420s1c1
Sequence:CCGGACGCTAACAAATACTGGGATACTCGAGTATCCCAGTATTTGTTAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145524.1-503s1c1
Sequence:CCGGCCTGAAATCCTTCCTGTTAATCTCGAGATTAACAGGAAGGATTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145524.1-1483s1c1
Sequence:CCGGCCGAACTATGTGTCATGTTAACTCGAGTTAACATGACACATAGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145524.3-995s21c1
Sequence:CCGGCGACGGCTTAGCCTACCCTTTCTCGAGAAAGGGTAGGCTAAGCCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145524.3-582s21c1
Sequence:CCGGCCTGAAATCCTTCCTGTTAATCTCGAGATTAACAGGAAGGATTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145524.3-527s21c1
Sequence:CCGGCCAGACCCATAAGAATAAGTTCTCGAGAACTTATTCTTATGGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332231    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145524.3-1436s21c1
Sequence:CCGGCCGAACTATGTGTCATGTTAACTCGAGTTAACATGACACATAGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145524
VALIDATED
METTL8 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 8
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145524.1-916s1c1
Sequence:CCGGCGACGGCTTAGCCTACCCTTTCTCGAGAAAGGGTAGGCTAAGCCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145524.1-448s1c1
Sequence:CCGGCCAGACCCATAAGAATAAGTTCTCGAGAACTTATTCTTATGGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145524.1-420s1c1
Sequence:CCGGACGCTAACAAATACTGGGATACTCGAGTATCCCAGTATTTGTTAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145524.1-503s1c1
Sequence:CCGGCCTGAAATCCTTCCTGTTAATCTCGAGATTAACAGGAAGGATTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145524.1-1483s1c1
Sequence:CCGGCCGAACTATGTGTCATGTTAACTCGAGTTAACATGACACATAGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145524.3-995s21c1
Sequence:CCGGCGACGGCTTAGCCTACCCTTTCTCGAGAAAGGGTAGGCTAAGCCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145524.3-582s21c1
Sequence:CCGGCCTGAAATCCTTCCTGTTAATCTCGAGATTAACAGGAAGGATTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145524.3-527s21c1
Sequence:CCGGCCAGACCCATAAGAATAAGTTCTCGAGAACTTATTCTTATGGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332231    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145524.3-1436s21c1
Sequence:CCGGCCGAACTATGTGTCATGTTAACTCGAGTTAACATGACACATAGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)