EMAIL THIS PAGE TO A FRIEND

METTL9

methyltransferase like 9

190 Gene Product Result for
Synonyms: DREV DREV1 PAP1
UniProtKB ID: Q9H1A3, Q8NBT8, Q9BWJ7, Q9H1A2, Q9Y390
Gene ID:
Mouse(59052) methyltransferase like 9
Rat(100302453) methyltransferase like 9
Zebrafish(768200) methyltransferase like 9
cow(787067) methyltransferase like 9
domestic cat(101090981) methyltransferase like 9
dog(479809) methyltransferase like 9
chicken(416623) methyltransferase like 9
Goat(100861266) methyltransferase like 9
sheep(101115339) methyltransferase like 9
naked mole-rat(101714915) methyltransferase like 9
domestic guinea pig(100719820) methyltransferase like 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016025 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016025 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016025 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021554 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021554 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021554 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077180 Rosetta Predictions human pricing
NM_016025 Rosetta Predictions human pricing
NM_021554 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312074 predicted 713
2 SASI_Hs02_00312075 predicted 590
3 SASI_Hs02_00312076 predicted 714
4 SASI_Hs02_00312077 predicted 662
5 SASI_Hs02_00312078 predicted 709
6 SASI_Hs02_00312079 predicted 1188
7 SASI_Hs02_00312080 predicted 582
8 SASI_Hs02_00312081 predicted 586
9 SASI_Hs02_00312082 predicted 553
10 SASI_Hs02_00312083 predicted 1195
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185855 predicted 714
2 SASI_Hs01_00185856 predicted 596
3 SASI_Hs02_00348717 predicted 710
4 SASI_Hs02_00348718 predicted 657
5 SASI_Hs02_00348719 predicted 707
6 SASI_Hs02_00348720 predicted 1185
7 SASI_Hs01_00185858 predicted 582
8 SASI_Hs02_00348721 predicted 590
9 SASI_Hs01_00185859 predicted 552
10 SASI_Hs02_00348722 predicted 1203
11 SASI_Hs01_00185854 predicted 758
12 SASI_Hs01_00185857 predicted 712
13 SASI_Hs01_00185860 predicted 1034
14 SASI_Hs01_00185861 predicted 838
15 SASI_Hs01_00185862 predicted 1081
16 SASI_Hs01_00185863 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021554 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076731 predicted 629
2 SASI_Mm01_00076732 predicted 795
3 SASI_Mm01_00076733 predicted 580
4 SASI_Mm01_00076735 predicted 880
5 SASI_Mm01_00076736 predicted 528
6 SASI_Mm01_00076737 predicted 930
7 SASI_Mm02_00326324 predicted 1137
8 SASI_Mm01_00076738 predicted 1151
9 SASI_Mm01_00076739 predicted 754
10 SASI_Mm01_00076740 predicted 691
11 SASI_Mm01_00076734 predicted 692
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016025
VALIDATED
METTL9 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 9
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016025.3-477s21c1
Sequence:CCGGGCTGGCTATTTATCCAATTATCTCGAGATAATTGGATAAATAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016025.3-410s21c1
Sequence:CCGGGTCTTTGTTCAGAGTTACCTTCTCGAGAAGGTAACTCTGAACAAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016025.3-2800s21c1
Sequence:CCGGGCAGAAGTGATGGATGTTCAACTCGAGTTGAACATCCATCACTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016025.3-1013s21c1
Sequence:CCGGCAAGTGAATAGTCTGCCTGAACTCGAGTTCAGGCAGACTATTCACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130661    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016025.2-2506s1c1
Sequence:CCGGCCACTGTTACTGTGCAGTCATCTCGAGATGACTGCACAGTAACAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016025.2-354s1c1
Sequence:CCGGGTCTTTGTTCAGAGTTACCTTCTCGAGAAGGTAACTCTGAACAAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130306    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016025.2-2241s1c1
Sequence:CCGGGCAGAGCATTTAACCCAGAATCTCGAGATTCTGGGTTAAATGCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016025.2-2744s1c1
Sequence:CCGGGCAGAAGTGATGGATGTTCAACTCGAGTTGAACATCCATCACTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016025.2-537s1c1
Sequence:CCGGGATCAGTTTCAGAGACTGCTTCTCGAGAAGCAGTCTCTGAAACTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016025.2-957s1c1
Sequence:CCGGCAAGTGAATAGTCTGCCTGAACTCGAGTTCAGGCAGACTATTCACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016025.2-658s1c1
Sequence:CCGGCCACTGAGCTTTCTGAAACTACTCGAGTAGTTTCAGAAAGCTCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016025
VALIDATED
METTL9 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 9
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016025.3-477s21c1
Sequence:CCGGGCTGGCTATTTATCCAATTATCTCGAGATAATTGGATAAATAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016025.3-410s21c1
Sequence:CCGGGTCTTTGTTCAGAGTTACCTTCTCGAGAAGGTAACTCTGAACAAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016025.3-2800s21c1
Sequence:CCGGGCAGAAGTGATGGATGTTCAACTCGAGTTGAACATCCATCACTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016025.3-1013s21c1
Sequence:CCGGCAAGTGAATAGTCTGCCTGAACTCGAGTTCAGGCAGACTATTCACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130661    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016025.2-2506s1c1
Sequence:CCGGCCACTGTTACTGTGCAGTCATCTCGAGATGACTGCACAGTAACAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016025.2-354s1c1
Sequence:CCGGGTCTTTGTTCAGAGTTACCTTCTCGAGAAGGTAACTCTGAACAAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130306    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016025.2-2241s1c1
Sequence:CCGGGCAGAGCATTTAACCCAGAATCTCGAGATTCTGGGTTAAATGCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016025.2-2744s1c1
Sequence:CCGGGCAGAAGTGATGGATGTTCAACTCGAGTTGAACATCCATCACTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016025.2-537s1c1
Sequence:CCGGGATCAGTTTCAGAGACTGCTTCTCGAGAAGCAGTCTCTGAAACTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016025.2-957s1c1
Sequence:CCGGCAAGTGAATAGTCTGCCTGAACTCGAGTTCAGGCAGACTATTCACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016025.2-658s1c1
Sequence:CCGGCCACTGAGCTTTCTGAAACTACTCGAGTAGTTTCAGAAAGCTCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016025
VALIDATED
METTL9 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 9
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016025.3-477s21c1
Sequence:CCGGGCTGGCTATTTATCCAATTATCTCGAGATAATTGGATAAATAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016025.3-410s21c1
Sequence:CCGGGTCTTTGTTCAGAGTTACCTTCTCGAGAAGGTAACTCTGAACAAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016025.3-2800s21c1
Sequence:CCGGGCAGAAGTGATGGATGTTCAACTCGAGTTGAACATCCATCACTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016025.3-1013s21c1
Sequence:CCGGCAAGTGAATAGTCTGCCTGAACTCGAGTTCAGGCAGACTATTCACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130661    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016025.2-2506s1c1
Sequence:CCGGCCACTGTTACTGTGCAGTCATCTCGAGATGACTGCACAGTAACAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016025.2-354s1c1
Sequence:CCGGGTCTTTGTTCAGAGTTACCTTCTCGAGAAGGTAACTCTGAACAAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130306    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016025.2-2241s1c1
Sequence:CCGGGCAGAGCATTTAACCCAGAATCTCGAGATTCTGGGTTAAATGCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016025.2-2744s1c1
Sequence:CCGGGCAGAAGTGATGGATGTTCAACTCGAGTTGAACATCCATCACTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016025.2-537s1c1
Sequence:CCGGGATCAGTTTCAGAGACTGCTTCTCGAGAAGCAGTCTCTGAAACTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016025.2-957s1c1
Sequence:CCGGCAAGTGAATAGTCTGCCTGAACTCGAGTTCAGGCAGACTATTCACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016025.2-658s1c1
Sequence:CCGGCCACTGAGCTTTCTGAAACTACTCGAGTAGTTTCAGAAAGCTCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021554
VALIDATED
METTL9 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 9
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021554.2-1094s21c1
Sequence:CCGGCCTTTCATCCCTATGTAGAAACTCGAGTTTCTACATAGGGATGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021554.2-976s1c1
Sequence:CCGGGATGTCATCAGCTGCTTAAATCTCGAGATTTAAGCAGCTGATGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021554.2-1622s21c1
Sequence:CCGGCCCAGACAAAGCAATAGTCATCTCGAGATGACTATTGCTTTGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021554.2-1300s21c1
Sequence:CCGGGTCTTTGTTCTCAGACCAGTACTCGAGTACTGGTCTGAGAACAAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021554.2-954s21c1
Sequence:CCGGGCAGAATACAGGGTTCCAGTACTCGAGTACTGGAACCCTGTATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021554.2-1276s1c1
Sequence:CCGGGACTACTATGTTCTGGACGATCTCGAGATCGTCCAGAACATAGTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021554.2-1302s1c1
Sequence:CCGGCTTTGTTCTCAGACCAGTATACTCGAGTATACTGGTCTGAGAACAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197945    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021554.2-1690s1c1
Sequence:CCGGGCAATAAAGCTGTCCATTCAACTCGAGTTGAATGGACAGCTTTATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021554.2-954s1c1
Sequence:CCGGGCAGAATACAGGGTTCCAGTACTCGAGTACTGGAACCCTGTATTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021554.2-1622s1c1
Sequence:CCGGCCCAGACAAAGCAATAGTCATCTCGAGATGACTATTGCTTTGTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021554.2-1094s1c1
Sequence:CCGGCCTTTCATCCCTATGTAGAAACTCGAGTTTCTACATAGGGATGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021554.2-1263s1c1
Sequence:CCGGCGACATGTACAATGACTACTACTCGAGTAGTAGTCATTGTACATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021554.2-1300s1c1
Sequence:CCGGGTCTTTGTTCTCAGACCAGTACTCGAGTACTGGTCTGAGAACAAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021554
VALIDATED
METTL9 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 9
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021554.2-1094s21c1
Sequence:CCGGCCTTTCATCCCTATGTAGAAACTCGAGTTTCTACATAGGGATGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021554.2-976s1c1
Sequence:CCGGGATGTCATCAGCTGCTTAAATCTCGAGATTTAAGCAGCTGATGACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021554.2-1622s21c1
Sequence:CCGGCCCAGACAAAGCAATAGTCATCTCGAGATGACTATTGCTTTGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021554.2-1300s21c1
Sequence:CCGGGTCTTTGTTCTCAGACCAGTACTCGAGTACTGGTCTGAGAACAAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021554.2-954s21c1
Sequence:CCGGGCAGAATACAGGGTTCCAGTACTCGAGTACTGGAACCCTGTATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021554.2-1276s1c1
Sequence:CCGGGACTACTATGTTCTGGACGATCTCGAGATCGTCCAGAACATAGTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021554.2-1302s1c1
Sequence:CCGGCTTTGTTCTCAGACCAGTATACTCGAGTATACTGGTCTGAGAACAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197945    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021554.2-1690s1c1
Sequence:CCGGGCAATAAAGCTGTCCATTCAACTCGAGTTGAATGGACAGCTTTATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021554.2-954s1c1
Sequence:CCGGGCAGAATACAGGGTTCCAGTACTCGAGTACTGGAACCCTGTATTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021554.2-1622s1c1
Sequence:CCGGCCCAGACAAAGCAATAGTCATCTCGAGATGACTATTGCTTTGTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021554.2-1094s1c1
Sequence:CCGGCCTTTCATCCCTATGTAGAAACTCGAGTTTCTACATAGGGATGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021554.2-1263s1c1
Sequence:CCGGCGACATGTACAATGACTACTACTCGAGTAGTAGTCATTGTACATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021554.2-1300s1c1
Sequence:CCGGGTCTTTGTTCTCAGACCAGTACTCGAGTACTGGTCTGAGAACAAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021554
VALIDATED
METTL9 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 9
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021554.2-1094s21c1
Sequence:CCGGCCTTTCATCCCTATGTAGAAACTCGAGTTTCTACATAGGGATGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021554.2-976s1c1
Sequence:CCGGGATGTCATCAGCTGCTTAAATCTCGAGATTTAAGCAGCTGATGACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021554.2-1622s21c1
Sequence:CCGGCCCAGACAAAGCAATAGTCATCTCGAGATGACTATTGCTTTGTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021554.2-1300s21c1
Sequence:CCGGGTCTTTGTTCTCAGACCAGTACTCGAGTACTGGTCTGAGAACAAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021554.2-954s21c1
Sequence:CCGGGCAGAATACAGGGTTCCAGTACTCGAGTACTGGAACCCTGTATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021554.2-1276s1c1
Sequence:CCGGGACTACTATGTTCTGGACGATCTCGAGATCGTCCAGAACATAGTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021554.2-1302s1c1
Sequence:CCGGCTTTGTTCTCAGACCAGTATACTCGAGTATACTGGTCTGAGAACAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197945    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021554.2-1690s1c1
Sequence:CCGGGCAATAAAGCTGTCCATTCAACTCGAGTTGAATGGACAGCTTTATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021554.2-954s1c1
Sequence:CCGGGCAGAATACAGGGTTCCAGTACTCGAGTACTGGAACCCTGTATTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021554.2-1622s1c1
Sequence:CCGGCCCAGACAAAGCAATAGTCATCTCGAGATGACTATTGCTTTGTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021554.2-1094s1c1
Sequence:CCGGCCTTTCATCCCTATGTAGAAACTCGAGTTTCTACATAGGGATGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021554.2-1263s1c1
Sequence:CCGGCGACATGTACAATGACTACTACTCGAGTAGTAGTCATTGTACATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021554.2-1300s1c1
Sequence:CCGGGTCTTTGTTCTCAGACCAGTACTCGAGTACTGGTCTGAGAACAAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)