EMAIL THIS PAGE TO A FRIEND

MEX3A

mex-3 RNA binding family member A

63 Gene Product Result for
Synonyms: MEX-3A RKHD4
UniProtKB ID: A1L020
Gene ID:
Mouse(72640) mex3 homolog A (C. elegans)
Rat(310631) mex3 homolog A (C. elegans)
chicken(426350) mex-3 homolog A (C. elegans)
chicken(101747646) mex-3 homolog A (C. elegans)
cow(618154) mex-3 homolog A (C. elegans)
Horse(100063974) mex-3 homolog A (C. elegans)
domestic cat(101086447) mex-3 homolog A (C. elegans)
dog(490417) mex-3 homolog A (C. elegans)
chicken(101666224) mex-3 homolog A (C. elegans)
domestic guinea pig(100720730) mex-3 homolog A (C. elegans)
naked mole-rat(101700663) mex-3 homolog A (C. elegans)
sheep(101107659) mex-3 homolog A (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA062703 Anti-MEX3A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
PRS4869 Anti-RKHD4 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029890 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001029890 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001029890 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001093725 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001093725 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001093725 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU169631 MISSION® esiRNA esiRNA targeting mouse Mex3a mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001093725 Rosetta Predictions human pricing
XM_044166 Rosetta Predictions human pricing
XM_227403 Rosetta Predictions rat pricing
XR_008935 Rosetta Predictions rat pricing
NM_001029890 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001093725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318093 predicted 1979
2 SASI_Hs02_00318094 predicted 1447
3 SASI_Hs02_00318095 predicted 871
4 SASI_Hs02_00318096 predicted 1957
5 SASI_Hs02_00318097 predicted 1532
6 SASI_Hs02_00318098 predicted 1502
7 SASI_Hs02_00318099 predicted 2018
8 SASI_Hs02_00318100 predicted 738
9 SASI_Hs02_00318101 predicted 746
10 SASI_Hs02_00318102 predicted 1970
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_044166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271231 predicted 719
2 SASI_Hs01_00271232 predicted 1827
3 SASI_Hs01_00271233 predicted 1805
4 SASI_Hs01_00271234 predicted 355
5 SASI_Hs01_00271235 predicted 1662
6 SASI_Hs01_00271236 predicted 294
7 SASI_Hs01_00271237 predicted 1796
8 SASI_Hs01_00271238 predicted 270
9 SASI_Hs01_00271239 predicted 1845
10 SASI_Hs01_00271240 predicted 1349
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227403 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384371 predicted 1116
2 SASI_Rn02_00384372 predicted 665
3 SASI_Rn02_00384373 predicted 534
4 SASI_Rn02_00384374 predicted 775
5 SASI_Rn02_00384375 predicted 869
6 SASI_Rn02_00384376 predicted 454
7 SASI_Rn02_00384377 predicted 911
8 SASI_Rn02_00384378 predicted 809
9 SASI_Rn02_00384379 predicted 880
10 SASI_Rn02_00384380 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008935 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00176490 predicted 943
2 SASI_Rn01_00176492 predicted 485
3 SASI_Rn01_00176493 predicted 361
4 SASI_Rn01_00176494 predicted 591
5 SASI_Rn01_00176495 predicted 684
6 SASI_Rn01_00176496 predicted 272
7 SASI_Rn01_00176497 predicted 735
8 SASI_Rn01_00176498 predicted 620
9 SASI_Rn01_00176499 predicted 701
10 SASI_Rn02_00418266 predicted 315
11 SASI_Rn01_00176491 predicted 1115
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029890 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072157 predicted 701
2 SASI_Mm01_00072158 predicted 446
3 SASI_Mm02_00288049 predicted 652
4 SASI_Mm01_00072160 predicted 985
5 SASI_Mm01_00072161 predicted 1105
6 SASI_Mm01_00072162 predicted 320
7 SASI_Mm01_00072163 predicted 498
8 SASI_Mm01_00072164 predicted 696
9 SASI_Mm01_00072165 predicted 230
10 SASI_Mm01_00072166 predicted 233
11 SASI_Mm01_00072159 predicted 532
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029890
VALIDATED
MEX3A MISSION shRNA Bacterial Glycerol Stock
mex-3 RNA binding family member A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029890.1-324s1c1
Sequence:CCGGGCAGACCAACACGTACATCATCTCGAGATGATGTACGTGTTGGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029890.1-160s1c1
Sequence:CCGGGCTGAGCACTTCTCCATGATACTCGAGTATCATGGAGAAGTGCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029890.1-449s1c1
Sequence:CCGGGCAAGATTCTTGAATACAACACTCGAGTGTTGTATTCAAGAATCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029890.1-2278s21c1
Sequence:CCGGGCACCTAGCTGAACCATTATTCTCGAGAATAATGGTTCAGCTAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029890.1-162s21c1
Sequence:CCGGTGAGCACTTCTCCATGATAAGCTCGAGCTTATCATGGAGAAGTGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029890.1-698s21c1
Sequence:CCGGGCAAGCAGGACGTGTACTATGCTCGAGCATAGTACACGTCCTGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216164    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029890.1-3867s1c1
Sequence:CCGGCGATACTCAAGATAGCTTAAACTCGAGTTTAAGCTATCTTGAGTATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216746    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029890.1-2278s1c1
Sequence:CCGGGCACCTAGCTGAACCATTATTCTCGAGAATAATGGTTCAGCTAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029890.1-1108s21c1
Sequence:CCGGACACAAGCCATCCGAATATTTCTCGAGAAATATTCGGATGGCTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029890.1-655s21c1
Sequence:CCGGGACTTTGGCTACAGCGGATATCTCGAGATATCCGCTGTAGCCAAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029890
VALIDATED
MEX3A MISSION shRNA shRNA Plasmid DNA
mex-3 RNA binding family member A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029890.1-324s1c1
Sequence:CCGGGCAGACCAACACGTACATCATCTCGAGATGATGTACGTGTTGGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029890.1-160s1c1
Sequence:CCGGGCTGAGCACTTCTCCATGATACTCGAGTATCATGGAGAAGTGCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029890.1-449s1c1
Sequence:CCGGGCAAGATTCTTGAATACAACACTCGAGTGTTGTATTCAAGAATCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029890.1-2278s21c1
Sequence:CCGGGCACCTAGCTGAACCATTATTCTCGAGAATAATGGTTCAGCTAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029890.1-162s21c1
Sequence:CCGGTGAGCACTTCTCCATGATAAGCTCGAGCTTATCATGGAGAAGTGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029890.1-698s21c1
Sequence:CCGGGCAAGCAGGACGTGTACTATGCTCGAGCATAGTACACGTCCTGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216164    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029890.1-3867s1c1
Sequence:CCGGCGATACTCAAGATAGCTTAAACTCGAGTTTAAGCTATCTTGAGTATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216746    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029890.1-2278s1c1
Sequence:CCGGGCACCTAGCTGAACCATTATTCTCGAGAATAATGGTTCAGCTAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029890.1-1108s21c1
Sequence:CCGGACACAAGCCATCCGAATATTTCTCGAGAAATATTCGGATGGCTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029890.1-655s21c1
Sequence:CCGGGACTTTGGCTACAGCGGATATCTCGAGATATCCGCTGTAGCCAAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029890
VALIDATED
MEX3A MISSION shRNA Lentiviral Transduction Particles
mex-3 RNA binding family member A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029890.1-324s1c1
Sequence:CCGGGCAGACCAACACGTACATCATCTCGAGATGATGTACGTGTTGGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029890.1-160s1c1
Sequence:CCGGGCTGAGCACTTCTCCATGATACTCGAGTATCATGGAGAAGTGCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029890.1-449s1c1
Sequence:CCGGGCAAGATTCTTGAATACAACACTCGAGTGTTGTATTCAAGAATCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029890.1-2278s21c1
Sequence:CCGGGCACCTAGCTGAACCATTATTCTCGAGAATAATGGTTCAGCTAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029890.1-162s21c1
Sequence:CCGGTGAGCACTTCTCCATGATAAGCTCGAGCTTATCATGGAGAAGTGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029890.1-698s21c1
Sequence:CCGGGCAAGCAGGACGTGTACTATGCTCGAGCATAGTACACGTCCTGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216164    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029890.1-3867s1c1
Sequence:CCGGCGATACTCAAGATAGCTTAAACTCGAGTTTAAGCTATCTTGAGTATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216746    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029890.1-2278s1c1
Sequence:CCGGGCACCTAGCTGAACCATTATTCTCGAGAATAATGGTTCAGCTAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029890.1-1108s21c1
Sequence:CCGGACACAAGCCATCCGAATATTTCTCGAGAAATATTCGGATGGCTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029890.1-655s21c1
Sequence:CCGGGACTTTGGCTACAGCGGATATCTCGAGATATCCGCTGTAGCCAAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001093725
MEX3A MISSION shRNA Bacterial Glycerol Stock
mex-3 RNA binding family member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001093725.1-5932s21c1
Sequence:GTACCGGCTAGTGAAGACACGTACAAATCTCGAGATTTGTACGTGTCTTCACTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093725.1-1536s21c1
Sequence:CCGGCACGCAAGCCATCCGAATATTCTCGAGAATATTCGGATGGCTTGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093725.1-754s21c1
Sequence:CCGGCAAACCAACACATACATTATCCTCGAGGATAATGTATGTGTTGGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093725.1-448s21c1
Sequence:CCGGAGGCAAGGCTGCAAGATTAAGCTCGAGCTTAATCTTGCAGCCTTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093725.1-341s21c1
Sequence:CCGGAGCTCTGCGCTCTCTACAAAGCTCGAGCTTTGTAGAGAGCGCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001093725
MEX3A MISSION shRNA shRNA Plasmid DNA
mex-3 RNA binding family member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001093725.1-5932s21c1
Sequence:GTACCGGCTAGTGAAGACACGTACAAATCTCGAGATTTGTACGTGTCTTCACTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093725.1-1536s21c1
Sequence:CCGGCACGCAAGCCATCCGAATATTCTCGAGAATATTCGGATGGCTTGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093725.1-754s21c1
Sequence:CCGGCAAACCAACACATACATTATCCTCGAGGATAATGTATGTGTTGGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093725.1-448s21c1
Sequence:CCGGAGGCAAGGCTGCAAGATTAAGCTCGAGCTTAATCTTGCAGCCTTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093725.1-341s21c1
Sequence:CCGGAGCTCTGCGCTCTCTACAAAGCTCGAGCTTTGTAGAGAGCGCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001093725
MEX3A MISSION shRNA Lentiviral Transduction Particles
mex-3 RNA binding family member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001093725.1-5932s21c1
Sequence:GTACCGGCTAGTGAAGACACGTACAAATCTCGAGATTTGTACGTGTCTTCACTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093725.1-1536s21c1
Sequence:CCGGCACGCAAGCCATCCGAATATTCTCGAGAATATTCGGATGGCTTGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093725.1-754s21c1
Sequence:CCGGCAAACCAACACATACATTATCCTCGAGGATAATGTATGTGTTGGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093725.1-448s21c1
Sequence:CCGGAGGCAAGGCTGCAAGATTAAGCTCGAGCTTAATCTTGCAGCCTTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093725.1-341s21c1
Sequence:CCGGAGCTCTGCGCTCTCTACAAAGCTCGAGCTTTGTAGAGAGCGCAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)