EMAIL THIS PAGE TO A FRIEND

MEX3B

mex-3 RNA binding family member B

183 Gene Product Result for
Synonyms: MEX-3B RKHD3 RNF195
UniProtKB ID: Q6ZN04, Q4G0W1, Q8IVG2, Q9H0J0
Gene ID:
Human(84206) Summary: This gene encodes an RNA-binding phosphoprotein that is part of the MEX3 (muscle excess 3) family of translational regulators. The encoded protein contains N-terminal nuclear export and nuclear localization signals and is exported from the cytoplasm to the nucleus. The protein binds to RNA via two KH domains and also colocalizes with MEX3A, Dcp1A decapping factor and Argonaute proteins within P (processing) bodies. [provided by RefSeq, Oct 2012]
Mouse(108797) mex3 homolog B (C. elegans)
Rat(308790) mex3 homolog B (C. elegans)
sheep(101107903) mex-3 homolog B (C. elegans)
naked mole-rat(101710460) mex-3 homolog B (C. elegans)
Domestic Rabbit(100353875) mex-3 homolog B (C. elegans)
domestic guinea pig(100728833) mex-3 homolog B (C. elegans)
Zebrafish(569582) mex-3 homolog B (C. elegans)
dog(488759) mex-3 homolog B (C. elegans)
domestic cat(101088243) mex-3 homolog B (C. elegans)
cow(539904) mex-3 homolog B (C. elegans)
Horse(100052950) mex-3 homolog B (C. elegans)
chicken(770748) mex-3 homolog B (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032246 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032246 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032246 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175366 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175366 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175366 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU154531 MISSION® esiRNA esiRNA human RKHD3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032246 Rosetta Predictions human pricing
XM_001068105 Rosetta Predictions rat pricing
XM_218846 Rosetta Predictions rat pricing
XM_620516 Rosetta Predictions mouse pricing
XM_912460 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032246 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064252 predicted 2476
2 SASI_Hs01_00064253 predicted 991
3 SASI_Hs01_00064254 predicted 2445
4 SASI_Hs01_00064255 predicted 2443
5 SASI_Hs01_00064256 predicted 1051
6 SASI_Hs02_00359555 predicted 2432
7 SASI_Hs01_00064257 predicted 910
8 SASI_Hs01_00064258 predicted 1245
9 SASI_Hs01_00064259 predicted 1006
10 SASI_Hs01_00064260 predicted 972
11 SASI_Hs01_00064251 predicted 2488
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068105 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323462 predicted 3349
2 SASI_Rn02_00323463 predicted 281
3 SASI_Rn02_00323464 predicted 1951
4 SASI_Rn02_00323465 predicted 1942
5 SASI_Rn02_00323466 predicted 2285
6 SASI_Rn02_00323467 predicted 2030
7 SASI_Rn02_00323468 predicted 3220
8 SASI_Rn02_00323469 predicted 3234
9 SASI_Rn02_00323470 predicted 2327
10 SASI_Rn02_00323471 predicted 2464
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218846 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378122 predicted 275
2 SASI_Rn02_00378123 predicted 314
3 SASI_Rn02_00378124 predicted 512
4 SASI_Rn02_00378125 predicted 220
5 SASI_Rn02_00378126 predicted 864
6 SASI_Rn02_00378127 predicted 1058
7 SASI_Rn02_00378128 predicted 1817
8 SASI_Rn02_00378129 predicted 915
9 SASI_Rn02_00378130 predicted 469
10 SASI_Rn02_00378131 predicted 1768
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_620516 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276870 predicted 2278
2 SASI_Mm01_00276871 predicted 882
3 SASI_Mm01_00276872 predicted 866
4 SASI_Mm01_00276873 predicted 1038
5 SASI_Mm01_00276874 predicted 963
6 SASI_Mm01_00276875 predicted 1255
7 SASI_Mm01_00276877 predicted 1066
8 SASI_Mm01_00276878 predicted 747
9 SASI_Mm02_00427633 predicted 980
10 SASI_Mm01_00276879 predicted 1298
11 SASI_Mm01_00276876 predicted 2385
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_912460 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00437104 predicted 2116
2 SASI_Mm02_00437105 predicted 200
3 SASI_Mm02_00437106 predicted 353
4 SASI_Mm02_00437107 predicted 712
5 SASI_Mm02_00437108 predicted 877
6 SASI_Mm02_00437109 predicted 806
7 SASI_Mm02_00437110 predicted 1093
8 SASI_Mm02_00437111 predicted 902
9 SASI_Mm02_00437112 predicted 589
10 SASI_Mm02_00437113 predicted 1139
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032246
MEX3B MISSION shRNA Bacterial Glycerol Stock
mex-3 RNA binding family member B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032246.3-971s21c1
Sequence:CCGGAGGAGATTGAGGCGCACATTGCTCGAGCAATGTGCGCCTCAATCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032246.3-1198s21c1
Sequence:CCGGGCTTCCACAGACTCTTATTTCCTCGAGGAAATAAGAGTCTGTGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032246.3-1301s21c1
Sequence:CCGGACAACGGAAACAATAACAATACTCGAGTATTGTTATTGTTTCCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032246.3-2181s21c1
Sequence:CCGGAGCTGTAGTATCCGCTCATTTCTCGAGAAATGAGCGGATACTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032246.3-592s21c1
Sequence:CCGGCGGGCGAAGACCAATACTTACCTCGAGGTAAGTATTGGTCTTCGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032246.3-1299s1c1
Sequence:CCGGGCACAACGGAAACAATAACAACTCGAGTTGTTATTGTTTCCGTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032246.3-597s1c1
Sequence:CCGGGAAGACCAATACTTACATCAACTCGAGTTGATGTAAGTATTGGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032246.3-492s1c1
Sequence:CCGGGCGCAAGAAGAGCGTGAACATCTCGAGATGTTCACGCTCTTCTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032246.3-1487s1c1
Sequence:CCGGCGGTATCTTCTTCCTGCTCTTCTCGAGAAGAGCAGGAAGAAGATACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032246.3-3229s1c1
Sequence:CCGGGCCTTTAACCTCATGGTCAAACTCGAGTTTGACCATGAGGTTAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032246
MEX3B MISSION shRNA shRNA Plasmid DNA
mex-3 RNA binding family member B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032246.3-971s21c1
Sequence:CCGGAGGAGATTGAGGCGCACATTGCTCGAGCAATGTGCGCCTCAATCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032246.3-1198s21c1
Sequence:CCGGGCTTCCACAGACTCTTATTTCCTCGAGGAAATAAGAGTCTGTGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032246.3-1301s21c1
Sequence:CCGGACAACGGAAACAATAACAATACTCGAGTATTGTTATTGTTTCCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032246.3-2181s21c1
Sequence:CCGGAGCTGTAGTATCCGCTCATTTCTCGAGAAATGAGCGGATACTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032246.3-592s21c1
Sequence:CCGGCGGGCGAAGACCAATACTTACCTCGAGGTAAGTATTGGTCTTCGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032246.3-1299s1c1
Sequence:CCGGGCACAACGGAAACAATAACAACTCGAGTTGTTATTGTTTCCGTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032246.3-597s1c1
Sequence:CCGGGAAGACCAATACTTACATCAACTCGAGTTGATGTAAGTATTGGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032246.3-492s1c1
Sequence:CCGGGCGCAAGAAGAGCGTGAACATCTCGAGATGTTCACGCTCTTCTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032246.3-1487s1c1
Sequence:CCGGCGGTATCTTCTTCCTGCTCTTCTCGAGAAGAGCAGGAAGAAGATACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032246.3-3229s1c1
Sequence:CCGGGCCTTTAACCTCATGGTCAAACTCGAGTTTGACCATGAGGTTAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032246
MEX3B MISSION shRNA Lentiviral Transduction Particles
mex-3 RNA binding family member B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032246.3-971s21c1
Sequence:CCGGAGGAGATTGAGGCGCACATTGCTCGAGCAATGTGCGCCTCAATCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032246.3-1198s21c1
Sequence:CCGGGCTTCCACAGACTCTTATTTCCTCGAGGAAATAAGAGTCTGTGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032246.3-1301s21c1
Sequence:CCGGACAACGGAAACAATAACAATACTCGAGTATTGTTATTGTTTCCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032246.3-2181s21c1
Sequence:CCGGAGCTGTAGTATCCGCTCATTTCTCGAGAAATGAGCGGATACTACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032246.3-592s21c1
Sequence:CCGGCGGGCGAAGACCAATACTTACCTCGAGGTAAGTATTGGTCTTCGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032246.3-1299s1c1
Sequence:CCGGGCACAACGGAAACAATAACAACTCGAGTTGTTATTGTTTCCGTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032246.3-597s1c1
Sequence:CCGGGAAGACCAATACTTACATCAACTCGAGTTGATGTAAGTATTGGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032246.3-492s1c1
Sequence:CCGGGCGCAAGAAGAGCGTGAACATCTCGAGATGTTCACGCTCTTCTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032246.3-1487s1c1
Sequence:CCGGCGGTATCTTCTTCCTGCTCTTCTCGAGAAGAGCAGGAAGAAGATACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032246.3-3229s1c1
Sequence:CCGGGCCTTTAACCTCATGGTCAAACTCGAGTTTGACCATGAGGTTAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175366
MEX3B MISSION shRNA Bacterial Glycerol Stock
mex-3 RNA binding family member B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000040607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175366.2-296s1c1
Sequence:CCGGGCGGGAGAGCACCACCTTGCTCTCGAGAGCAAGGTGGTGCTCTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175366.2-360s1c1
Sequence:CCGGGCTGCCTATGCTAATGGGCTACTCGAGTAGCCCATTAGCATAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175366.2-491s1c1
Sequence:CCGGCCGCGACTGCTCTGTGTGCTTCTCGAGAAGCACACAGAGCAGTCGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175366.2-501s1c1
Sequence:CCGGTCTGTGTGCTTCGAGAGTGAACTCGAGTTCACTCTCGAAGCACACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175366
MEX3B MISSION shRNA shRNA Plasmid DNA
mex-3 RNA binding family member B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000040607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175366.2-296s1c1
Sequence:CCGGGCGGGAGAGCACCACCTTGCTCTCGAGAGCAAGGTGGTGCTCTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175366.2-360s1c1
Sequence:CCGGGCTGCCTATGCTAATGGGCTACTCGAGTAGCCCATTAGCATAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175366.2-491s1c1
Sequence:CCGGCCGCGACTGCTCTGTGTGCTTCTCGAGAAGCACACAGAGCAGTCGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175366.2-501s1c1
Sequence:CCGGTCTGTGTGCTTCGAGAGTGAACTCGAGTTCACTCTCGAAGCACACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175366
MEX3B MISSION shRNA Lentiviral Transduction Particles
mex-3 RNA binding family member B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000040607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175366.2-296s1c1
Sequence:CCGGGCGGGAGAGCACCACCTTGCTCTCGAGAGCAAGGTGGTGCTCTCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175366.2-360s1c1
Sequence:CCGGGCTGCCTATGCTAATGGGCTACTCGAGTAGCCCATTAGCATAGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175366.2-491s1c1
Sequence:CCGGCCGCGACTGCTCTGTGTGCTTCTCGAGAAGCACACAGAGCAGTCGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175366.2-501s1c1
Sequence:CCGGTCTGTGTGCTTCGAGAGTGAACTCGAGTTCACTCTCGAAGCACACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)