EMAIL THIS PAGE TO A FRIEND

MEX3C

mex-3 RNA binding family member C

164 Gene Product Result for
Synonyms: MEX-3C RKHD2 RNF194
UniProtKB ID: Q5U5Q3, A1L022, Q9NZE3
Gene ID:
Human(51320) Summary: This gene encodes a member of a family of proteins with two K homology (KH) RNA-binding domains and a C-terminal RING-finger domain. The protein interacts with mRNA via the KH domains, and the protein shuttles between the nucleus and cytoplasm. Polymorphisms in this gene may contribute to hypertension. [provided by RefSeq, Oct 2009]
Mouse(240396) mex3 homolog C (C. elegans)
Rat(307271) mex-3 homolog C (C. elegans)
dog(476195) mex-3 homolog C (C. elegans)
cow(529318) mex-3 homolog C (C. elegans)
Horse(100069803) mex-3 homolog C (C. elegans)
domestic cat(101095137) mex-3 homolog C (C. elegans)
domestic guinea pig(100713484) mex-3 homolog C (C. elegans)
naked mole-rat(101725068) mex-3 homolog C (C. elegans)
sheep(101113452) mex-3 homolog C (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016626 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016626 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016626 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039214 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039214 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039214 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016626 Rosetta Predictions human pricing
NM_001107377 Rosetta Predictions rat pricing
NM_001039214 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138176 predicted 1700
2 SASI_Hs01_00138177 predicted 1211
3 SASI_Hs01_00138178 predicted 989
4 SASI_Hs01_00138179 predicted 1211
5 SASI_Hs01_00138180 predicted 1304
6 SASI_Hs02_00349790 predicted 1207
7 SASI_Hs01_00138181 predicted 1029
8 SASI_Hs02_00349791 predicted 1069
9 SASI_Hs01_00138182 predicted 1736
10 SASI_Hs01_00138183 predicted 1459
11 SASI_Hs01_00138174 predicted 1079
12 SASI_Hs01_00138175 predicted 878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107377 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228225 predicted 778
2 SASI_Rn02_00228226 predicted 840
3 SASI_Rn02_00228227 predicted 1195
4 SASI_Rn02_00228228 predicted 533
5 SASI_Rn02_00228229 predicted 402
6 SASI_Rn02_00228230 predicted 875
7 SASI_Rn02_00228231 predicted 760
8 SASI_Rn02_00228232 predicted 322
9 SASI_Rn02_00228233 predicted 460
10 SASI_Rn02_00228234 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039214 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289951 predicted 1506
2 SASI_Mm02_00289952 predicted 1263
3 SASI_Mm02_00289953 predicted 1256
4 SASI_Mm02_00289954 predicted 1780
5 SASI_Mm02_00289955 predicted 1620
6 SASI_Mm02_00289956 predicted 1726
7 SASI_Mm02_00289957 predicted 1554
8 SASI_Mm02_00289958 predicted 2059
9 SASI_Mm02_00289959 predicted 1386
10 SASI_Mm02_00289960 predicted 1391
11 SASI_Mm01_00089426 predicted 1517
12 SASI_Mm01_00089427 predicted 1309
13 SASI_Mm01_00089428 predicted 963
14 SASI_Mm01_00089429 predicted 1188
15 SASI_Mm01_00089430 predicted 1530
16 SASI_Mm01_00089431 predicted 1287
17 SASI_Mm01_00089432 predicted 1691
18 SASI_Mm01_00089433 predicted 1422
19 SASI_Mm01_00089434 predicted 965
20 SASI_Mm01_00089435 predicted 1378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016626
VALIDATED
MEX3C MISSION shRNA Bacterial Glycerol Stock
mex-3 RNA binding family member C
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007687    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016626.2-2420s1c1
Sequence:CCGGGCACCTATATTGGCTGATAATCTCGAGATTATCAGCCAATATAGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016626.2-995s1c1
Sequence:CCGGCGCGCAAGAATGATATCCAATCTCGAGATTGGATATCATTCTTGCGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016626.2-466s1c1
Sequence:CCGGGAGAGCCAAGACAAACACGTACTCGAGTACGTGTTTGTCTTGGCTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016626.2-867s1c1
Sequence:CCGGCCATGCGTACAGGAAACTATACTCGAGTATAGTTTCCTGTACGCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016626.2-1502s1c1
Sequence:CCGGCGAAAGCACGACTGTGTGATTCTCGAGAATCACACAGTCGTGCTTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016626.3-1624s21c1
Sequence:CCGGCCTCGTCTGTCTCCTACATTTCTCGAGAAATGTAGGAGACAGACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016626.3-2020s21c1
Sequence:CCGGTCGTAAAGGCATGGGTATAATCTCGAGATTATACCCATGCCTTTACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016626.3-1177s21c1
Sequence:CCGGATGCGTACAGGAAACTATATACTCGAGTATATAGTTTCCTGTACGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016626.3-1307s21c1
Sequence:CCGGCAAGAATGATATCCAATTATCCTCGAGGATAATTGGATATCATTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016626.3-1028s21c1
Sequence:CCGGGACCCAAAGGAGCAACTATTACTCGAGTAATAGTTGCTCCTTTGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016626
VALIDATED
MEX3C MISSION shRNA shRNA Plasmid DNA
mex-3 RNA binding family member C
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007687    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016626.2-2420s1c1
Sequence:CCGGGCACCTATATTGGCTGATAATCTCGAGATTATCAGCCAATATAGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016626.2-995s1c1
Sequence:CCGGCGCGCAAGAATGATATCCAATCTCGAGATTGGATATCATTCTTGCGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016626.2-466s1c1
Sequence:CCGGGAGAGCCAAGACAAACACGTACTCGAGTACGTGTTTGTCTTGGCTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016626.2-867s1c1
Sequence:CCGGCCATGCGTACAGGAAACTATACTCGAGTATAGTTTCCTGTACGCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016626.2-1502s1c1
Sequence:CCGGCGAAAGCACGACTGTGTGATTCTCGAGAATCACACAGTCGTGCTTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016626.3-1624s21c1
Sequence:CCGGCCTCGTCTGTCTCCTACATTTCTCGAGAAATGTAGGAGACAGACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016626.3-2020s21c1
Sequence:CCGGTCGTAAAGGCATGGGTATAATCTCGAGATTATACCCATGCCTTTACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016626.3-1177s21c1
Sequence:CCGGATGCGTACAGGAAACTATATACTCGAGTATATAGTTTCCTGTACGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016626.3-1307s21c1
Sequence:CCGGCAAGAATGATATCCAATTATCCTCGAGGATAATTGGATATCATTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016626.3-1028s21c1
Sequence:CCGGGACCCAAAGGAGCAACTATTACTCGAGTAATAGTTGCTCCTTTGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016626
VALIDATED
MEX3C MISSION shRNA Lentiviral Transduction Particles
mex-3 RNA binding family member C
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007687    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016626.2-2420s1c1
Sequence:CCGGGCACCTATATTGGCTGATAATCTCGAGATTATCAGCCAATATAGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016626.2-995s1c1
Sequence:CCGGCGCGCAAGAATGATATCCAATCTCGAGATTGGATATCATTCTTGCGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016626.2-466s1c1
Sequence:CCGGGAGAGCCAAGACAAACACGTACTCGAGTACGTGTTTGTCTTGGCTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016626.2-867s1c1
Sequence:CCGGCCATGCGTACAGGAAACTATACTCGAGTATAGTTTCCTGTACGCATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016626.2-1502s1c1
Sequence:CCGGCGAAAGCACGACTGTGTGATTCTCGAGAATCACACAGTCGTGCTTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016626.3-1624s21c1
Sequence:CCGGCCTCGTCTGTCTCCTACATTTCTCGAGAAATGTAGGAGACAGACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016626.3-2020s21c1
Sequence:CCGGTCGTAAAGGCATGGGTATAATCTCGAGATTATACCCATGCCTTTACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016626.3-1177s21c1
Sequence:CCGGATGCGTACAGGAAACTATATACTCGAGTATATAGTTTCCTGTACGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016626.3-1307s21c1
Sequence:CCGGCAAGAATGATATCCAATTATCCTCGAGGATAATTGGATATCATTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016626.3-1028s21c1
Sequence:CCGGGACCCAAAGGAGCAACTATTACTCGAGTAATAGTTGCTCCTTTGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039214
VALIDATED
MEX3C MISSION shRNA Bacterial Glycerol Stock
mex-3 RNA binding family member C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229532    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039214.4-2834s21c1
Sequence:CCGGTTACTAGATCACTGGTTATAACTCGAGTTATAACCAGTGATCTAGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039214.4-1095s21c1
Sequence:CCGGAGCCAAGACAAACACGTATATCTCGAGATATACGTGTTTGTCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039214.4-1942s21c1
Sequence:CCGGCCTCGTCTGTCTCCTACATTTCTCGAGAAATGTAGGAGACAGACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039214.4-1464s21c1
Sequence:GTACCGGAGCACGAGAAGAGATAGAAATCTCGAGATTTCTATCTCTTCTCGTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039214.4-1264s21c1
Sequence:CCGGGGGTTATCGTGTAGTCCTAATCTCGAGATTAGGACTACACGATAACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039214
VALIDATED
MEX3C MISSION shRNA shRNA Plasmid DNA
mex-3 RNA binding family member C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229532    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039214.4-2834s21c1
Sequence:CCGGTTACTAGATCACTGGTTATAACTCGAGTTATAACCAGTGATCTAGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039214.4-1095s21c1
Sequence:CCGGAGCCAAGACAAACACGTATATCTCGAGATATACGTGTTTGTCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039214.4-1942s21c1
Sequence:CCGGCCTCGTCTGTCTCCTACATTTCTCGAGAAATGTAGGAGACAGACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039214.4-1464s21c1
Sequence:GTACCGGAGCACGAGAAGAGATAGAAATCTCGAGATTTCTATCTCTTCTCGTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039214.4-1264s21c1
Sequence:CCGGGGGTTATCGTGTAGTCCTAATCTCGAGATTAGGACTACACGATAACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039214
VALIDATED
MEX3C MISSION shRNA Lentiviral Transduction Particles
mex-3 RNA binding family member C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229532    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039214.4-2834s21c1
Sequence:CCGGTTACTAGATCACTGGTTATAACTCGAGTTATAACCAGTGATCTAGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039214.4-1095s21c1
Sequence:CCGGAGCCAAGACAAACACGTATATCTCGAGATATACGTGTTTGTCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039214.4-1942s21c1
Sequence:CCGGCCTCGTCTGTCTCCTACATTTCTCGAGAAATGTAGGAGACAGACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039214.4-1464s21c1
Sequence:GTACCGGAGCACGAGAAGAGATAGAAATCTCGAGATTTCTATCTCTTCTCGTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039214.4-1264s21c1
Sequence:CCGGGGGTTATCGTGTAGTCCTAATCTCGAGATTAGGACTACACGATAACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)