EMAIL THIS PAGE TO A FRIEND

MEX3D

mex-3 RNA binding family member D

69 Gene Product Result for
Synonyms: MEX-3D MEX3 OK/SW-cl.4 RKHD1 RNF193 TINO
UniProtKB ID: Q86XN8, A0PJL8, A1L023, E9PAL6, Q71M49
Gene ID:
Mouse(237400) mex3 homolog D (C. elegans)
Rat(299613) mex-3 homolog D (C. elegans)
sheep(101116229) mex-3 homolog D (C. elegans)
domestic guinea pig(100712953) mex-3 homolog D (C. elegans)
chicken(420082) mex-3 homolog D (C. elegans)
cow(538945) mex-3 homolog D (C. elegans)
dog(612270) mex-3 homolog D (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198615 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198615 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198615 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_203304 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203304 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203304 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU064691 MISSION® esiRNA esiRNA targeting mouse Mex3d (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203304 Rosetta Predictions human pricing
XM_001076492 Rosetta Predictions rat pricing
XM_234921 Rosetta Predictions rat pricing
NM_198615 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203304 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373237 predicted 646
2 SASI_Hs02_00373238 predicted 726
3 SASI_Hs01_00186345 predicted 942
4 SASI_Hs01_00186346 predicted 798
5 SASI_Hs02_00373239 predicted 715
6 SASI_Hs01_00186347 predicted 996
7 SASI_Hs02_00373240 predicted 730
8 SASI_Hs01_00186351 predicted 1009
9 SASI_Hs01_00186353 predicted 896
10 SASI_Hs01_00186354 predicted 1063
11 SASI_Hs01_00186348 predicted 204
12 SASI_Hs01_00186349 predicted 1258
13 SASI_Hs01_00186350 predicted 420
14 SASI_Hs01_00186352 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076492 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353429 predicted 1255
2 SASI_Rn02_00353430 predicted 1858
3 SASI_Rn02_00353431 predicted 1656
4 SASI_Rn02_00353432 predicted 954
5 SASI_Rn02_00353433 predicted 2102
6 SASI_Rn02_00353434 predicted 1247
7 SASI_Rn02_00353435 predicted 394
8 SASI_Rn02_00353436 predicted 2120
9 SASI_Rn02_00353437 predicted 619
10 SASI_Rn02_00353438 predicted 1811
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234921 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388768 predicted 1458
2 SASI_Rn02_00388769 predicted 2057
3 SASI_Rn02_00388770 predicted 1853
4 SASI_Rn02_00388771 predicted 1155
5 SASI_Rn02_00388772 predicted 2307
6 SASI_Rn02_00388773 predicted 1446
7 SASI_Rn02_00388774 predicted 596
8 SASI_Rn02_00388775 predicted 2316
9 SASI_Rn02_00388776 predicted 820
10 SASI_Rn02_00388777 predicted 2014
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198615 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351037 predicted 1043
2 SASI_Mm02_00351038 predicted 1446
3 SASI_Mm01_00099556 predicted 1334
4 SASI_Mm01_00099557 predicted 2148
5 SASI_Mm02_00351039 predicted 2305
6 SASI_Mm02_00351040 predicted 899
7 SASI_Mm02_00351041 predicted 962
8 SASI_Mm02_00351042 predicted 2056
9 SASI_Mm02_00351043 predicted 877
10 SASI_Mm02_00351044 predicted 823
11 SASI_Mm01_00099555 predicted 492
12 SASI_Mm01_00099558 predicted 470
13 SASI_Mm01_00099559 predicted 579
14 SASI_Mm01_00099560 predicted 589
15 SASI_Mm01_00099561 predicted 435
16 SASI_Mm01_00099562 predicted 1293
17 SASI_Mm01_00099563 predicted 516
18 SASI_Mm01_00099564 predicted 264
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198615
MEX3D MISSION shRNA Bacterial Glycerol Stock
mex-3 RNA binding family member D
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198615.2-2720s21c1
Sequence:CCGGTACAACTCTCACTGGATTTAACTCGAGTTAAATCCAGTGAGAGTTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198615.2-901s21c1
Sequence:CCGGGTGATCGGGAGTCGCAAGAAACTCGAGTTTCTTGCGACTCCCGATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198615.2-2851s21c1
Sequence:CCGGGTGGACAAGAGGAGGGTAATGCTCGAGCATTACCCTCCTCTTGTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198615.2-2297s21c1
Sequence:CCGGTGGATTGTGCTGTCCGCATCTCTCGAGAGATGCGGACAGCACAATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198615.1-594s1c1
Sequence:CCGGGACGTGTGTCTAGACCTGTTACTCGAGTAACAGGTCTAGACACACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198615.1-449s1c1
Sequence:CCGGGCGCGACAAGGAACCAGTGTTCTCGAGAACACTGGTTCCTTGTCGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198615.1-567s1c1
Sequence:CCGGGACAGTGACTTCCATGCCAATCTCGAGATTGGCATGGAAGTCACTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198615.1-413s1c1
Sequence:CCGGCCAGCAAAGGACGCACACGTACTCGAGTACGTGTGCGTCCTTTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198615.1-1739s1c1
Sequence:CCGGCCGGTGACAATAAACCGGAAACTCGAGTTTCCGGTTTATTGTCACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198615
MEX3D MISSION shRNA shRNA Plasmid DNA
mex-3 RNA binding family member D
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198615.2-2720s21c1
Sequence:CCGGTACAACTCTCACTGGATTTAACTCGAGTTAAATCCAGTGAGAGTTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198615.2-901s21c1
Sequence:CCGGGTGATCGGGAGTCGCAAGAAACTCGAGTTTCTTGCGACTCCCGATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198615.2-2851s21c1
Sequence:CCGGGTGGACAAGAGGAGGGTAATGCTCGAGCATTACCCTCCTCTTGTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198615.2-2297s21c1
Sequence:CCGGTGGATTGTGCTGTCCGCATCTCTCGAGAGATGCGGACAGCACAATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198615.1-594s1c1
Sequence:CCGGGACGTGTGTCTAGACCTGTTACTCGAGTAACAGGTCTAGACACACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198615.1-449s1c1
Sequence:CCGGGCGCGACAAGGAACCAGTGTTCTCGAGAACACTGGTTCCTTGTCGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198615.1-567s1c1
Sequence:CCGGGACAGTGACTTCCATGCCAATCTCGAGATTGGCATGGAAGTCACTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198615.1-413s1c1
Sequence:CCGGCCAGCAAAGGACGCACACGTACTCGAGTACGTGTGCGTCCTTTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198615.1-1739s1c1
Sequence:CCGGCCGGTGACAATAAACCGGAAACTCGAGTTTCCGGTTTATTGTCACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198615
MEX3D MISSION shRNA Lentiviral Transduction Particles
mex-3 RNA binding family member D
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198615.2-2720s21c1
Sequence:CCGGTACAACTCTCACTGGATTTAACTCGAGTTAAATCCAGTGAGAGTTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198615.2-901s21c1
Sequence:CCGGGTGATCGGGAGTCGCAAGAAACTCGAGTTTCTTGCGACTCCCGATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198615.2-2851s21c1
Sequence:CCGGGTGGACAAGAGGAGGGTAATGCTCGAGCATTACCCTCCTCTTGTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198615.2-2297s21c1
Sequence:CCGGTGGATTGTGCTGTCCGCATCTCTCGAGAGATGCGGACAGCACAATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198615.1-594s1c1
Sequence:CCGGGACGTGTGTCTAGACCTGTTACTCGAGTAACAGGTCTAGACACACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198615.1-449s1c1
Sequence:CCGGGCGCGACAAGGAACCAGTGTTCTCGAGAACACTGGTTCCTTGTCGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198615.1-567s1c1
Sequence:CCGGGACAGTGACTTCCATGCCAATCTCGAGATTGGCATGGAAGTCACTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198615.1-413s1c1
Sequence:CCGGCCAGCAAAGGACGCACACGTACTCGAGTACGTGTGCGTCCTTTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198615.1-1739s1c1
Sequence:CCGGCCGGTGACAATAAACCGGAAACTCGAGTTTCCGGTTTATTGTCACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203304
VALIDATED
MEX3D MISSION shRNA Bacterial Glycerol Stock
mex-3 RNA binding family member D
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203304.3-2187s21c1
Sequence:CCGGGAGTGGTCAGGTTACAATAAACTCGAGTTTATTGTAACCTGACCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203304.3-1926s21c1
Sequence:CCGGGGCCACCCAGGCCATTCATATCTCGAGATATGAATGGCCTGGGTGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203304.3-505s21c1
Sequence:CCGGGTGATCGGCAGCCGCAAGAAACTCGAGTTTCTTGCGGCTGCCGATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203304.3-1356s21c1
Sequence:CCGGCTTCGGCTTCGACTTCGACTTCTCGAGAAGTCGAAGTCGAAGCCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203304.3-729s21c1
Sequence:CCGGGGCCGAACACTTCTCCATCATCTCGAGATGATGGAGAAGTGTTCGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203304.1-522s1c2
Sequence:CCGGCGACAGCGACTTCCACGCCAACTCGAGTTGGCGTGGAAGTCGCTGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_203304.1-1451s1c1
Sequence:CCGGCAGCCCTTCAACGACAGTATTCTCGAGAATACTGTCGTTGAAGGGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_203304.1-93s1c1
Sequence:CCGGCAAGACAAACACCTACATCAACTCGAGTTGATGTAGGTGTTTGTCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_203304.1-831s1c1
Sequence:CCGGCGGCTTCGACTTCGACTTCCTCTCGAGAGGAAGTCGAAGTCGAAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_203304.1-405s1c1
Sequence:CCGGGCGCGACAAGGAGCCGGTGTTCTCGAGAACACCGGCTCCTTGTCGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_203304.1-522s1c1
Sequence:CCGGCGACAGCGACTTCCACGCCAACTCGAGTTGGCGTGGAAGTCGCTGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203304
VALIDATED
MEX3D MISSION shRNA shRNA Plasmid DNA
mex-3 RNA binding family member D
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203304.3-2187s21c1
Sequence:CCGGGAGTGGTCAGGTTACAATAAACTCGAGTTTATTGTAACCTGACCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203304.3-1926s21c1
Sequence:CCGGGGCCACCCAGGCCATTCATATCTCGAGATATGAATGGCCTGGGTGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203304.3-505s21c1
Sequence:CCGGGTGATCGGCAGCCGCAAGAAACTCGAGTTTCTTGCGGCTGCCGATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203304.3-1356s21c1
Sequence:CCGGCTTCGGCTTCGACTTCGACTTCTCGAGAAGTCGAAGTCGAAGCCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203304.3-729s21c1
Sequence:CCGGGGCCGAACACTTCTCCATCATCTCGAGATGATGGAGAAGTGTTCGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203304.1-522s1c2
Sequence:CCGGCGACAGCGACTTCCACGCCAACTCGAGTTGGCGTGGAAGTCGCTGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_203304.1-1451s1c1
Sequence:CCGGCAGCCCTTCAACGACAGTATTCTCGAGAATACTGTCGTTGAAGGGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_203304.1-93s1c1
Sequence:CCGGCAAGACAAACACCTACATCAACTCGAGTTGATGTAGGTGTTTGTCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_203304.1-831s1c1
Sequence:CCGGCGGCTTCGACTTCGACTTCCTCTCGAGAGGAAGTCGAAGTCGAAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_203304.1-405s1c1
Sequence:CCGGGCGCGACAAGGAGCCGGTGTTCTCGAGAACACCGGCTCCTTGTCGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_203304.1-522s1c1
Sequence:CCGGCGACAGCGACTTCCACGCCAACTCGAGTTGGCGTGGAAGTCGCTGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203304
VALIDATED
MEX3D MISSION shRNA Lentiviral Transduction Particles
mex-3 RNA binding family member D
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203304.3-2187s21c1
Sequence:CCGGGAGTGGTCAGGTTACAATAAACTCGAGTTTATTGTAACCTGACCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203304.3-1926s21c1
Sequence:CCGGGGCCACCCAGGCCATTCATATCTCGAGATATGAATGGCCTGGGTGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203304.3-505s21c1
Sequence:CCGGGTGATCGGCAGCCGCAAGAAACTCGAGTTTCTTGCGGCTGCCGATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203304.3-1356s21c1
Sequence:CCGGCTTCGGCTTCGACTTCGACTTCTCGAGAAGTCGAAGTCGAAGCCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203304.3-729s21c1
Sequence:CCGGGGCCGAACACTTCTCCATCATCTCGAGATGATGGAGAAGTGTTCGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203304.1-522s1c2
Sequence:CCGGCGACAGCGACTTCCACGCCAACTCGAGTTGGCGTGGAAGTCGCTGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_203304.1-1451s1c1
Sequence:CCGGCAGCCCTTCAACGACAGTATTCTCGAGAATACTGTCGTTGAAGGGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_203304.1-93s1c1
Sequence:CCGGCAAGACAAACACCTACATCAACTCGAGTTGATGTAGGTGTTTGTCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_203304.1-831s1c1
Sequence:CCGGCGGCTTCGACTTCGACTTCCTCTCGAGAGGAAGTCGAAGTCGAAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_203304.1-405s1c1
Sequence:CCGGGCGCGACAAGGAGCCGGTGTTCTCGAGAACACCGGCTCCTTGTCGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_203304.1-522s1c1
Sequence:CCGGCGACAGCGACTTCCACGCCAACTCGAGTTGGCGTGGAAGTCGCTGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)