EMAIL THIS PAGE TO A FRIEND

MFAP1

microfibrillar-associated protein 1

30 Gene Product Result for
UniProtKB ID: P55081, Q86TG6
Gene ID:
Zebrafish(393992) microfibrillar-associated protein 1
fruit fly(38256) Microfibril-associated protein 1
cow(510905) microfibrillar-associated protein 1
Horse(100070739) microfibrillar-associated protein 1
domestic cat(101096071) microfibrillar-associated protein 1
dog(478281) microfibrillar-associated protein 1
chicken(415586) microfibrillar-associated protein 1
sheep(101110271) microfibrillar-associated protein 1
domestic guinea pig(100726139) microfibrillar-associated protein 1
naked mole-rat(101698180) microfibrillar-associated protein 1
Domestic Rabbit(100328689) microfibrillar-associated protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005926 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005926 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005926 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU101761 MISSION® esiRNA esiRNA human AE000659.1 (esiRNA6) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005926 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025678 predicted 438
2 SASI_Hs02_00340567 predicted 973
3 SASI_Hs01_00025681 predicted 1188
4 SASI_Hs02_00340568 predicted 877
5 SASI_Hs01_00025683 predicted 1159
6 SASI_Hs01_00025684 predicted 441
7 SASI_Hs01_00025686 predicted 1085
8 SASI_Hs02_00340569 predicted 959
9 SASI_Hs02_00340570 predicted 1180
10 SASI_Hs02_00340571 predicted 1106
11 SASI_Hs01_00025677 predicted 1378
12 SASI_Hs01_00025679 predicted 1413
13 SASI_Hs01_00025680 predicted 1609
14 SASI_Hs01_00025682 predicted 1420
15 SASI_Hs01_00025685 predicted 1301
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005926
VALIDATED
MFAP1 MISSION shRNA Bacterial Glycerol Stock
microfibrillar-associated protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005926.2-1897s1c1
Sequence:CCGGCGGAAATCTAAGCTCATGGAACTCGAGTTCCATGAGCTTAGATTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005926.2-1016s1c1
Sequence:CCGGGCATGGAAAGTTCGAGAGCTACTCGAGTAGCTCTCGAACTTTCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005926.2-892s1c1
Sequence:CCGGGCGCAAGTACACACTCAAGATCTCGAGATCTTGAGTGTGTACTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005926.2-1346s1c1
Sequence:CCGGCGCACCAAATACACTCACCTTCTCGAGAAGGTGAGTGTATTTGGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005926.2-443s1c1
Sequence:CCGGCGGCGTTTACAGAACCGTATTCTCGAGAATACGGTTCTGTAAACGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005926.2-1500s21c1
Sequence:CCGGCCTAGGGTCCAACTGCTTATTCTCGAGAATAAGCAGTTGGACCCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005926.2-963s21c1
Sequence:CCGGCTGCATTGGATGCACTCAATACTCGAGTATTGAGTGCATCCAATGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_005926.2-1873s21c1
Sequence:CCGGCCTTAGGTTTAGGAGTAATATCTCGAGATATTACTCCTAAACCTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005926.2-1143s21c1
Sequence:CCGGGGGCAAACGGCAAAGTCATTACTCGAGTAATGACTTTGCCGTTTGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005926.2-1270s21c1
Sequence:CCGGTCCTACCCTGGAGGATCATTTCTCGAGAAATGATCCTCCAGGGTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005926
VALIDATED
MFAP1 MISSION shRNA shRNA Plasmid DNA
microfibrillar-associated protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005926.2-1897s1c1
Sequence:CCGGCGGAAATCTAAGCTCATGGAACTCGAGTTCCATGAGCTTAGATTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005926.2-1016s1c1
Sequence:CCGGGCATGGAAAGTTCGAGAGCTACTCGAGTAGCTCTCGAACTTTCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005926.2-892s1c1
Sequence:CCGGGCGCAAGTACACACTCAAGATCTCGAGATCTTGAGTGTGTACTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005926.2-1346s1c1
Sequence:CCGGCGCACCAAATACACTCACCTTCTCGAGAAGGTGAGTGTATTTGGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005926.2-443s1c1
Sequence:CCGGCGGCGTTTACAGAACCGTATTCTCGAGAATACGGTTCTGTAAACGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005926.2-1500s21c1
Sequence:CCGGCCTAGGGTCCAACTGCTTATTCTCGAGAATAAGCAGTTGGACCCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005926.2-963s21c1
Sequence:CCGGCTGCATTGGATGCACTCAATACTCGAGTATTGAGTGCATCCAATGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_005926.2-1873s21c1
Sequence:CCGGCCTTAGGTTTAGGAGTAATATCTCGAGATATTACTCCTAAACCTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005926.2-1143s21c1
Sequence:CCGGGGGCAAACGGCAAAGTCATTACTCGAGTAATGACTTTGCCGTTTGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005926.2-1270s21c1
Sequence:CCGGTCCTACCCTGGAGGATCATTTCTCGAGAAATGATCCTCCAGGGTAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005926
VALIDATED
MFAP1 MISSION shRNA Lentiviral Transduction Particles
microfibrillar-associated protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005926.2-1897s1c1
Sequence:CCGGCGGAAATCTAAGCTCATGGAACTCGAGTTCCATGAGCTTAGATTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005926.2-1016s1c1
Sequence:CCGGGCATGGAAAGTTCGAGAGCTACTCGAGTAGCTCTCGAACTTTCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005926.2-892s1c1
Sequence:CCGGGCGCAAGTACACACTCAAGATCTCGAGATCTTGAGTGTGTACTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005926.2-1346s1c1
Sequence:CCGGCGCACCAAATACACTCACCTTCTCGAGAAGGTGAGTGTATTTGGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005926.2-443s1c1
Sequence:CCGGCGGCGTTTACAGAACCGTATTCTCGAGAATACGGTTCTGTAAACGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005926.2-1500s21c1
Sequence:CCGGCCTAGGGTCCAACTGCTTATTCTCGAGAATAAGCAGTTGGACCCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005926.2-963s21c1
Sequence:CCGGCTGCATTGGATGCACTCAATACTCGAGTATTGAGTGCATCCAATGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_005926.2-1873s21c1
Sequence:CCGGCCTTAGGTTTAGGAGTAATATCTCGAGATATTACTCCTAAACCTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005926.2-1143s21c1
Sequence:CCGGGGGCAAACGGCAAAGTCATTACTCGAGTAATGACTTTGCCGTTTGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005926.2-1270s21c1
Sequence:CCGGTCCTACCCTGGAGGATCATTTCTCGAGAAATGATCCTCCAGGGTAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)